Trollius asiaticus

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Trollius

At a glance

Occurrence records3 996

Data sources11

Biological traits22

DNA specimens8

eDNA detections3

Sources11 archives

Databases and archives Trollius asiaticus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 996 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF3 996 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trollius asiaticus, the Asian globeflower, is an ornamental plant of the family Ranunculaceae, which is native to Asia and Europe. This plant usually grows in wet places, especially in grasslands and forests. It commonly grows to about 20 cm or higher.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Fruit length8.5 mm

Fruit length max9 mm

Fruit length min8 mm

Leaf length45 mm

Plant height0.375 m

Plant height max0.8 m

Plant height min0.05 m

Life cycle & reproduction7

Flower length max40 mm

Flower length min35 mm

Flowering endJun

Flowering startMay

Life formperennial

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Growth formherb

Habitat GIFTcut-overforest,forest,meadows:wet,parks

Mycorrhiza typearbuscular

Woodinessnon-woody

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trollius asiaticus has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes6

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL647870.1 ↗597 bpMongolia

ACGT

TCGAAACCTGCTCTGCAGAACGACCCGTGAACACGTGAAACAACACTGTTGTGGGGCGAGAGAGGGCGCAAGCCCTCGATTGTCCCATTG …

Trollius asiaticus voucher WHB 71093 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★rbcLa★ITS2★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trollius asiaticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode18records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1618×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +2

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.

CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1986. Chromosome numbers of some representatives of the families Apiaceae and Ranunculaceae from the south of Siberia. Bot. Žhurn. (Moscow & Leningrad) 71: 116–117.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk

CCDB · ipcn-api-dl — Krasnoborov, I. M., N. S. Krukova & V. V. Rubtsova. 1968. Nekotorye dekorativnye rastenija Zapadnogo Sajana i ikh khromosomnyj sostav. Introdukcija Dekorat. Rastenij dla Cvetnikov i Gazonov Sibiri. Novosibirsk. 1968: 30–34.

CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.

CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.

CCDB · ipcn-api-dl — Friesen, N. V. 1991. Chromosome numbers in members of the Ranunculaceae family from Siberia. Bot. Žhurn. (Moscow & Leningrad) 76: 905–907.

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1981. Chromosome numbers of some species of the family Ranunculaceae II. Bot. Zhurn. 66 (12): 1751–1755.

CCDB · ipcn-api-dl — Malakhova, L. A., O. L. Voronova & A. A. KOZLOVA. 1979. Chromosome numbers of some species of the flora of Sibirian lime-forests. Chernevaja Tajga i Problema Reliktov. Tomsk. 47–51.

CCDB · ipcn-api-dl — Belaeva, V. A. & V. Siplivinsky. 1981. In Chromosome number reports LXXIII. Taxon 30: 857–860.

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.

CCDB · book-ipcn75-78 — Kartashova et al. 1974

CCDB · book-ipcn75-78 — Krogulevich 1971

CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1975

CCDB · eflora

CCDB · iapt — IAPT/IOPB Chromosome Data 30

CCDB · iapt — IAPT/IOPB Chromosome Data 32

n 81×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — DOROSZEWSKA, A. 1970. Hybrids of Trollius pumilus Don with other species of the same genus. Acta Soc. Bot. Poloniae 39: 257-284.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 996 records

Wild obs. + sensor3 664

Museum / vouchered327

Cultivated / captive5

Range

Area of Occupancy AOO8 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 1 120≤1 km 302≤10 km 954>10 km 533

2 909 georeferenced · 755 without coordinates

Open the mapobservation + sensor3 664

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 9≤1 km 32≤10 km 71>10 km 15

127 georeferenced · 200 without coordinates

Open the institutions mapphysical evidence327

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	220
BRNUlocation not on record	14
Yangling, CN	10
Xining, CN	8
Tianjin Natural History Museumlocation not on record	7
Urumqi, CN	5
Bronx, US	4
Adam Mickiewicz University in Poznańlocation not on record	3
Beijing, CN	3
Durham, US	3
National Institute of Biological Resourceslocation not on record	3
Berlin, DE	2
Tampere, FI	2
Institute of the biological problems of the North FEB RASlocation not on record	2
Taipei, TW	2
TROMlocation not on record	2
ENTClocation not on record	1
CASlocation not on record	1
WTUlocation not on record	1
Urumqi, CN	1
Taipei, TW	1
Nanjing, CN	1
Saint Louis, US	1
Auckland, NZ	1
Bern, CH	1
Görlitz, DE	1
Podgorica, ME	1
Vitebsk State University named after P.M. Masherovlocation not on record	1
Komarov Botanical Institutelocation not on record	1
nbflocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
SLU Artdatabankenlocation not on record	1
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Tromso University Museumlocation not on record	1
KMNlocation not on record	1
Tampa, US	1

36 institutions · 310 of 327 vouchered records shown · 16 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Trollius asiaticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.20 °C -0.9–17.1

Seasonal swing summer↔winter34.9 °C

Max temp (day)6.00 °C 2.60–21.5

Min temp (night)2.80 °C -5.00–12.1

Precipitation39.8 mm/mo 37.2–55.9

Air humidity60.4 % 50.9–63.9

Moisture balance-37.6 mm/mo -110–-15.6

Vapour deficit364 Pa 306–1,058

Wind speed5.10 m/s 2.70–5.30

Cloud cover57.5 % 41.8–58.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trollius asiaticus

At a glance

Sources11 archives

Size & morphology7

Life cycle & reproduction7

Diet & foraging1

Habitat & environment7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 996 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 996 records