Trollius altaicus

C.A.Mey. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Trollius

At a glance

Occurrence records446

Data sources10

Biological traits33

DNA specimens1

eDNA detections2

Sources10 archives

Databases and archives Trollius altaicus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility446 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Occurrence & distributionGBIF446 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trollius altaicus is an ornamental plant of the family Ranunculaceae, which is native of Asia and Europe. This plant usually grows in wet places, specially in valleys.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length10 mm

Fruit length max10 mm

Fruit length min10 mm

Fruit width3.5 mm

Fruit width max3.5 mm

Fruit width min3.5 mm

Leaf length47.5 mm

Leaf length max60 mm

Leaf length min35 mm

Leaf width max110 mm

Leaf width min65 mm

Plant height max0.75 m

Plant height min0.15 m

Seed mass1.38 mg

Life cycle & reproduction7

Flower length max50 mm

Flower length min30 mm

Flowering endJul

Flowering startJun

Life formperennial

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Elevation max2 650 m

Elevation mean1 925 m

Elevation min900 m

Growth formherb

Habitat GIFTforest,meadows,mountains,parks

Mycorrhiza type0.000000339

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trollius altaicus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOQ848211.1 ↗652 bpRussia

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCTCTGCAGAACGACCCGTGAACACGTGAAACAACACTGTTGTGG …

Trollius altaicus isolate TALS1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trollius altaicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 167×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

CCDB · book-ipcn65 — M. Kurita 1965

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1981. Chromosome numbers of some species of the family Ranunculaceae II. Bot. Zhurn. 66 (12): 1751–1755.

CCDB · book-ipcn67-71 — DOROSZEWSKA, A. 1967. Chromosomes of some Trollius species. Act. Polsk. Towarz. Bot. 36: 567-577.

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.

CCDB · eflora

CCDB · iapt — IAPT/IOPB Chromosome Data 30

n 81×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — DOROSZEWSKA, A. 1970. Hybrids of Trollius pumilus Don with other species of the same genus. Acta Soc. Bot. Poloniae 39: 257-284.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type446 records

Wild obs. + sensor322

Museum / vouchered123

Cultivated / captive1

Range

Area of Occupancy AOO1 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 96≤1 km 61≤10 km 35>10 km 48

240 georeferenced · 82 without coordinates

Open the mapobservation + sensor322

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤1 km 20≤10 km 6

26 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence123

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	52
Urumqi, CN	16
Beijing, CN	13
Urumqi, CN	6
Durham, US	3
Saint Louis, US	3
Nanjing, CN	2
Austin, US	1
Edinburgh, GB	1
Bronx, US	1
BRNUlocation not on record	1
Kew, GB	1

12 institutions · 100 of 123 vouchered records shown · 22 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Trollius altaicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median2.60 °C -1.30–6.40

Seasonal swing summer↔winter34.3 °C

Max temp (day)5.60 °C 2.50–8.80

Min temp (night)-2.00 °C -6.00–2.00

Precipitation191 mm/mo 67.4–314

Air humidity62.7 % 60.9–64.5

Moisture balance126 mm/mo 17.1–235

Vapour deficit396 Pa 371–421

Wind speed2.50 m/s 2.20–2.80

Cloud cover51.5 % 46.0–57.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)