Trochocarpa thymifolia

(R.Br.) Spreng. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Trochocarpa

At a glance

Occurrence records684

Data sources7

Biological traits19

DNA specimens2

eDNA detections1

Sources7 archives

Databases and archives Trochocarpa thymifolia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility684 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF684 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Trochocarpa thymifolia is a species of flowering plant from the family Ericacae and is endemic to Tasmania. It is a widespread alpine and subalpine shrub with small leaves, pink to red flowers and blue to purple fruit. Originally described by botanist Robert Brown in 1810, it is a widespread Tasmanian endemic that inhabits the state's mountain regions. Flowers in Mount Field National Park

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFTWCVP

Size & morphology9

Leaf length2 mm

Leaf size1.57 mm²

Leaf width1 mm

Plant height0.9 m

Seed length6 mm

Seed mass2.76 mg

⚠ sources differ — TRY: 2.76 mg · AusTraits: 2.02 mg · GIFT: 2.88 mg

Seed mass max2.88 mg

Seed mass min2.88 mg

Seed width4.5 mm

Life cycle & reproduction4

Deciduousnessevergreen

Life spanperennial

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Habitat & environment6

Climatetemperate

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trochocarpa thymifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ667486.1 ↗534 bpAustralia

ACGT

GGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAA …

Trochocarpa thymifolia voucher JCU_IB09 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type684 records

Wild obs. + sensor444

Museum / vouchered235

Cultivated / captive5

Origin

Native36

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 211≤1 km 112≤10 km 43>10 km 6

372 georeferenced · 72 without coordinates

Open the mapobservation + sensor444

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 4≤1 km 105≤10 km 78>10 km 11

198 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence235

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 3 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	82
Museo Entomologico de Leonlocation not on record	43
Mount Annan, AU	36
Canberra, AU	32
QVMAGlocation not on record	19
Adelaide, AU	9
Armidale, AU	6
Brisbane, AU	4
MAlocation not on record	1
Kew, GB	1
Auckland, NZ	1
Palmerston, AU	1

12 institutions · 235 of 235 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Trochocarpa thymifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)