Trochocarpa cunninghamii

(DC.) W.M.Curtis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Trochocarpa

At a glance

Occurrence records961

Data sources6

Biological traits19

DNA specimens2

eDNA detections1

Sources6 archives

Databases and archives Trochocarpa cunninghamii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility961 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Occurrence & distributionGBIF961 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Trochocarpa cunninghamii is a flowering plant species of the family Ericaceae. It is commonly referred to as straggling purpleberry due to its round flattened mauve drupe fruits. This woody shrub is usually found in the understorey of rainforests and subalpine forests in the Central Plateau and western Tasmania, and is endemic to Tasmania.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRY

Size & morphology7

Leaf length10 mm

Leaf mass per area148 g/m2

Leaf size34 mm²

⚠ sources differ — TRY: 34 mm² · AusTraits: 31.42 mm²

Leaf width4 mm

Plant height1.25 m

⚠ sources differ — AusTraits: 1.25 m · TRY: 1.14 m

Seed length2 mm

Seed width1 mm

Life cycle & reproduction4

Deciduousnessevergreen

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Habitat & environment5

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)7.0 mm²/mg

Wood density600 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trochocarpa cunninghamii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ667479.1 ↗522 bpAustralia

ACGT

TATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCG …

Trochocarpa cunninghamii voucher JCU_IF09 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type961 records

Wild obs. + sensor745

Museum / vouchered215

Other1

Origin

Native15

Range

Area of Occupancy AOO1 880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 640≤1 km 48≤10 km 47>10 km 6

741 georeferenced · 4 without coordinates

Open the mapobservation + sensor745

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 4≤1 km 136≤10 km 47>10 km 7

194 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence215

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	133
Museo Entomologico de Leonlocation not on record	26
Canberra, AU	21
Mount Annan, AU	15
QVMAGlocation not on record	13
Adelaide, AU	4
Armidale, AU	1
Palmerston, AU	1

8 institutions · 214 of 215 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Trochocarpa cunninghamii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)