Trixa conspersa

(Harris, 1776) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Trixa

At a glance

Occurrence records783

Data sources7

Biological traits0

DNA specimens23

eDNA detections25

Sources7 archives

Databases and archives Trixa conspersa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility783 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF783 records

Environmental DNA2 datasets · 5 countries25 detections

DNA & barcodingBOLD23 specimens

01Narrative

Trixa conspersa is a species of fly in the family Tachinidae.James E. O'Hara, Hiroshi Shima, & Chuntian Zhang. "Annotated Catalogue of the Tachinidae (Insecta: Diptera) of China." Zootaxa 2190 (2009): 1-236. It is generally found in the meadows, hedgerows and woodland edge in Britain, around the month of May to the end of July.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trixa conspersa has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections25

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

22Amostly conserved

202Gmostly conserved

271Tvariable

274Tmostly conserved

301Tvariable

376Avariable

463Cvariable

519Tmostly conserved

622Avariable

AACATTATATTTTATTTTTGGAGCTTGGTCAGGAATAATTGGTACTTCCCTAAGTATTTTAATTCGAACAGAATTAGGCCATCCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes5

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trixa caerulescenssame genus10.5%Estheria bohemanisame family12.2%Helina troenesame order12.3%Pegomya flavifronssame order12.7%Cordyligaster capelliisame family12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type783 records

Wild obs. + sensor707

Museum / vouchered76

Range

Area of Occupancy AOO2 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 384≤1 km 144≤10 km 136>10 km 1

665 georeferenced · 42 without coordinates

Open the mapobservation + sensor707

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 23≤1 km 26≤10 km 16>10 km 1

66 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NCMGlocation not on record	10
SLU Artdatabankenlocation not on record	9
Helsinki, FI	6
University of Tokyo, Department of Zoologylocation not on record	5
CBDClocation not on record	4
Tromsø, NO	4
ZMAAlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
NHMOlocation not on record	1
South Kensington, GB	1
NMOKlocation not on record	1
Tilburg, NL	1
neflocation not on record	1

14 institutions · 47 of 76 vouchered records shown · 29 without an institution code

09Environmental DNA25 detections

Where the DNA of Trixa conspersa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys2

Countries5

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map5 countries0

Urban14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 8.10–17.8

Seasonal swing summer↔winter19.5 °C

Max temp (day)17.9 °C 9.90–22.2

Min temp (night)12.2 °C 4.10–13.1

Precipitation105 mm/mo 72.8–185

Air humidity60.6 % 59.0–66.7

Moisture balance8.30 mm/mo -11.2–81.6

Vapour deficit645 Pa 390–805

Wind speed2.30 m/s 2.00–4.80

Cloud cover48.7 % 35.1–56.5

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)