Trivia monacha

(da Costa, 1778) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Triviidae/Trivia

At a glance

Occurrence records7 795

Data sources8

Biological traits2

DNA specimens13

eDNA detections8

Sources8 archives

Databases and archives Trivia monacha's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 142 records↗

OBISOcean Biodiversity Information System2 653 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS7 795 records

Environmental DNA2 datasets · 4 countries8 detections

DNA & barcodingBOLD13 specimens

01Narrative

Trivia monacha, also known as the European cowrie or spotted cowrie, is a species of small sea snail, a marine gastropod mollusc in the family Triviidae, the trivias. The name Trivia means "common" and the word monacha means "solitary". It is worth comparing this species with the similar species Trivia arctica, the northern cowrie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trivia monacha has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes2

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 73% of positions are identical in every specimen.

Diversity (π)8.4%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 176 variable positions, in barcode order

40Tmostly conserved

46Cmostly conserved

55Cmostly conserved

61Gmostly conserved

74Cmostly conserved

85Gmostly conserved

88Tmostly conserved

91Gmostly conserved

94Amostly conserved

97Amostly conserved

100Tmostly conserved

106Tmostly conserved

109Gmostly conserved

110Cmostly conserved

112Gmostly conserved

136Cmostly conserved

143Gmostly conserved

145Amostly conserved

166Gmostly conserved

175Amostly conserved

190Tmostly conserved

193Cmostly conserved

205Cmostly conserved

212Tmostly conserved

223Gmostly conserved

229Amostly conserved

232Amostly conserved

238Cmostly conserved

250Tmostly conserved

263Cmostly conserved

268Gmostly conserved

274Tmostly conserved

280Gmostly conserved

281Cvariable

283Gmostly conserved

286Gmostly conserved

287Tmostly conserved

289Gmostly conserved

292Gmostly conserved

301Cmostly conserved

307Amostly conserved

310Gmostly conserved

311Gmostly conserved

313Tmostly conserved

316Tmostly conserved

322Gmostly conserved

325Tmostly conserved

334Gmostly conserved

352Tmostly conserved

355Gmostly conserved

358Tmostly conserved

364Amostly conserved

370Cmostly conserved

374Gmostly conserved

379Gmostly conserved

382Tmostly conserved

385Cmostly conserved

388Tmostly conserved

401Cmostly conserved

403Tmostly conserved

406Cmostly conserved

407Cmostly conserved

409Amostly conserved

412Gmostly conserved

415Tmostly conserved

424Cmostly conserved

451Tmostly conserved

476Amostly conserved

477Amostly conserved

478Amostly conserved

479Tmostly conserved

481Tmostly conserved

482Gmostly conserved

484Gmostly conserved

485Cmostly conserved

486Amostly conserved

487Avariable

488Tmostly conserved

489Tmostly conserved

491Cmostly conserved

492Cvariable

493Tmostly conserved

494Cvariable

496Gmostly conserved

497Tmostly conserved

498Tmostly conserved

499Tmostly conserved

500Gmostly conserved

502Tvariable

504Gmostly conserved

505Amostly conserved

506Tmostly conserved

507Cmostly conserved

508Avariable

509Gmostly conserved

510Tmostly conserved

511Gvariable

512Amostly conserved

513Amostly conserved

514Gvariable

517Amostly conserved

519Cmostly conserved

520Tmostly conserved

522Cmostly conserved

523Tmostly conserved

525Tmostly conserved

527Tmostly conserved

528Tmostly conserved

529Gvariable

530Tmostly conserved

532Gvariable

535Amostly conserved

536Cmostly conserved

538Tmostly conserved

540Cmostly conserved

542Cmostly conserved

544Avariable

545Cmostly conserved

547Gvariable

548Gmostly conserved

+56 more variable positions not shown

AACATTGTATATTTTATTTGGTATGTGGTCCGGGTTAGTTGGTACCGCACTTAGCTTGTTGATTCGGGCTGAGCTAGGTCAACCGGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trivia arcticasame genus14.7%Trivirostra hordaceasame family17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-V4

animal barcoderibosomal

08Occurrence & distribution

Record type7 795 records

Wild obs. + sensor4 611

Museum / vouchered2 787

Other397

Range

Area of Occupancy AOO9 308 km²

Depth

0–200 m sunlit1 586

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 13.5 m · max 220.5 m · 1 588 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 3 828≤1 km 209≤10 km 169>10 km 39

4 245 georeferenced · 366 without coordinates

Open the mapobservation + sensor4 611

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 126≤1 km 103≤10 km 55>10 km 32

316 georeferenced · 2 471 without coordinates

Open the institutions mapphysical evidence2 787

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	122
DASSHlocation not on record	98
PNHSlocation not on record	79
Institut Francais pour l'Etude de la Merlocation not on record	29
Cambridge, US	20
486location not on record	17
Stockholm, SE	14
Philadelphia, US	12
RBINS-Scientific Heritagelocation not on record	11
Paris, FR	10
Barcelona, ES	10
Brussels, BE	9
Frankfurt am Main	6
ULiègelocation not on record	5
Auckland, NZ	5
South Kensington, GB	5
CEFASlocation not on record	4
Santa Barbara Museum of Natural Historylocation not on record	4
Provincia di Livornolocation not on record	3
730location not on record	3
Champaign, US	3
Bergen, NO	2
Delaware Museum of Nature and Sciencelocation not on record	2
Natural History Museum of Utahlocation not on record	2
Natural History Museum, Londonlocation not on record	2
Citadel Hill, GB	2
Chongqing Museumlocation not on record	2
CASlocation not on record	1
Salzburg, AT	1
University of Aberdeenlocation not on record	1
ARMS-MBONlocation not on record	1
Denver, US	1
Gothenburg, SE	1
Norwegian Institute of Marine Researchlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Bergen, NO	1
NTNU-VMlocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1

38 institutions · 492 of 2 787 vouchered records shown · 2 without an institution code

09Environmental DNA8 detections

Where the DNA of Trivia monacha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries4

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map4 countries0

Sediment and macroalgaeSubtidal seagrass bed (Z.marina)Special Area of Conservation; protected; 9.4…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 10.1–14.9

Seasonal swing summer↔winter8.90 °C

Max temp (day)14.8 °C 12.8–16.3

Min temp (night)11.2 °C 6.80–13.0

Precipitation132 mm/mo 86.1–221

Air humidity64.9 % 63.5–69.0

Moisture balance44.4 mm/mo -8.50–132

Vapour deficit514 Pa 445–594

Wind speed5.30 m/s 4.80–6.40

Cloud cover54.7 % 49.2–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trivia monacha

At a glance

Sources8 archives

Habitat & environment2

At a glance

Record type7 795 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 795 records