Triunia youngiana

(C.Moore & F.Muell.) L.A.S.Johnson & B.G.Briggs · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Triunia

At a glance

Occurrence records861

Data sources10

Biological traits34

DNA specimens7

eDNA detections5

Sources10 archives

Databases and archives Triunia youngiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility861 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.37 Gbp↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF861 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceGoaT1.4 Gbp

01Narrative

Triunia youngiana, commonly known as red nut or spice bush, is a shrub of the family Proteaceae native to New South Wales and Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology15

Fruit length13.5 mm

Fruit width13.5 mm

Leaf length90 mm

Leaf length max130 mm

Leaf length min50 mm

Leaf mass per area98.4 g/m2

Leaf size1 784 mm²

⚠ sources differ — TRY: 1 784 mm² · AusTraits: 1 944 mm²

Leaf width22.5 mm

Leaf width max30 mm

Leaf width min15 mm

Petiole length0.45 cm

Plant height4 m

Plant height max4 m

Seed length9 mm

Seed width9 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timeynnnnnnnyyyy

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub · TRY: woody

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_obovate obovate

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)9.92 mm²/mg

Wood density698 mg/cm³

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Triunia youngiana has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences5

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU676104.1 ↗661 bp

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCCCAACAGAGAGACCCGCGAACATGTTGCATAAGGTTTGGTCCGCGAGCATTC …

Triunia youngiana 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceGoaT

The complete instruction manual Triunia youngiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 369 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Triunia youngiana1.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type861 records

Wild obs. + sensor594

Museum / vouchered255

Cultivated / captive3

Other9

Origin

Native76

Range

Area of Occupancy AOO1 168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 411≤1 km 43≤10 km 23>10 km 13

490 georeferenced · 104 without coordinates

Open the mapobservation + sensor594

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 44≤1 km 37≤10 km 85>10 km 42

208 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence255

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	76
Brisbane, AU	72
Museo Entomologico de Leonlocation not on record	32
Canberra, AU	22
Armidale, AU	20
Smithfield, AU	6
Kew, GB	5
Adelaide, AU	4
Paris, FR	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Kensington, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Hobart, AU	1
Palmerston, AU	1
La Trobe Universitylocation not on record	1

15 institutions · 246 of 255 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Triunia youngiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 17.0–19.1

Seasonal swing summer↔winter10.4 °C

Max temp (day)22.4 °C 21.5–23.2

Min temp (night)14.3 °C 13.2–15.4

Precipitation135 mm/mo 129–141

Air humidity63.0 % 62.1–63.9

Moisture balance29.9 mm/mo 18.0–41.7

Vapour deficit775 Pa 703–847

Wind speed2.10 m/s 1.60–2.70

Cloud cover24.6 % 24.4–24.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)