Tritonia squalida

(Aiton) Ker Gawl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Tritonia

At a glance

Occurrence records52

Data sources6

Biological traits15

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Tritonia squalida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility52 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF52 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Tritonia squalida là một loài thực vật có hoa trong họ Diên vĩ. Loài này được (Aiton) Ker Gawl. miêu tả khoa học đầu tiên năm 1802.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.4 m

Plant height min0.25 m

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max185 m

Elevation min155 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tritonia squalida has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPQ191183.1 ↗1 341 bpUnited Kingdom · 2023

ACGT

ATGTCACCACAAACAGAGACTAAAGCAAGTGCTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCGGAGTACGAA …

Tritonia squalida voucher 19990699 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Tritonia squalida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Oberlander2016

CCDB · ipcn-api-dl — de Vos, M. P. 1982. The African genus Tritonia Ker-Gawler (Iridaceae): Part 1. J.S. African Bot. 48: 105–163.

CCDB · ipcn-api-dl — Goldblatt, P. & M. Takei. 1997. Chromosome cytology of Iridaceae---patterns of variation, determination of ancestral base numbers, and modes of karyotype change. Ann. Missouri Bot. Gard. 84: 285–304.

CCDB · book-ipcn67-71 — GOLDBLATT, P. 1971. Cytological and morphological studies in the Southern African Iridaceae. J.S. African Bot. 37: 317-460.

CCDB · Oberlander2016 — De Vos, M.P. 1982;Goldblatt, P. & M. Takei, 1997

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type52 records

Wild obs. + sensor23

Museum / vouchered29

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 13≤1 km 2≤10 km 2

17 georeferenced · 6 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	19
Pretoria, ZA	8
Cape Town, ZA	1
Zürich, CH	1

4 institutions · 29 of 29 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)