Triticum aestivum
speciesAt a glance
Occurrence records123 307
Data sources10
Biological traits142
DNA specimens130
eDNA detections364
Sources10 archives
Databases and archives Triticum aestivum's data was compiled from.
WikipediaWikimedia Foundation2 languages↗
GBIFGlobal Biodiversity Information Facility123 307 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI364 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics130 specimens↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources142 traits
Chemical compositionNPASS7 compounds
Occurrence & distributionGBIF123 307 records
Environmental DNA3 datasets · 10 countries364 detections
DNA & barcodingBOLD130 specimens
Genome at a glanceCCDB2n = 42
01Narrative
Triticum aestivum subsp. aestivum - MHNT Common wheat (Triticum aestivum), also known as bread wheat, is a cultivated wheat species.Excellent resource for 20th century plant breeding.Standard reference for evolution and early history. About 95% of wheat produced worldwide is common wheat; it is the most widely grown of all crops and the cereal with the highest monetary yield.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology26
Inflorescence length max18 cm
Inflorescence length min6 cm
Leaf length168 mm
Leaf length max170 mm
Leaf mass134 mg
Leaf mass per area33 g/m2
Leaf size2 846 mm²
Leaf width8 mm
⚠ sources differ — AusTraits: 8 mm · GIFT: 7 mm
Leaf width max15 mm
Leaf width min6 mm
Plant height0.978 m
⚠ sources differ — GIFT: 0.978 m · AusTraits: 1 m · LEDA: 1.02 m · USDA: 1.01 m · TRY: 0.59 m
Plant height generative0.96 m
Plant height max1.6 m
Plant height min0.4 m
Seed length7.2 mm
Seed length max7.2 mm
Seed length min7.2 mm
Seed mass37.53 mg
⚠ sources differ — TRY: 37.53 mg · AusTraits: 35.96 mg · LEDA: 43.75 mg · GIFT: 39.75 mg
Seed mass max41.53 mg
Seed mass min25.88 mg
Seed volume37 mm³
Seed volume max37 mm³
Seed volume min37 mm³
Seed width3.6 mm
Seed width max3.6 mm
Seed width min3.6 mm
Life cycle & reproduction34
Bloom periodEarly Spring
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flower colouryellow
Flower conspicuousNo
Flowering endJul
Flowering startJun
Flowering timennnnnnnnyyyn
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formannual or biennial
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number472
Seed spread rateSlow
Seedling vigorHigh
Self fertilizationpresent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment32
Active growth periodFall, Winter and Spring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 200 m
Elevation mean600 m
Elevation min300 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: crop
Growth form USDABunch
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Low growing grassNo
Mycorrhiza typeAMNM
Root depth min18 in
Shape and orientationErect
Small grainYes
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min100 days
Leaf c435 mg/g
Leaf dry-matter content (LDMC)231 mg/g
Leaf n38.19 mg/g
Leaf p5.12 mg/g
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max100 in
Precipitation min10 in
Protein potentialHigh
Salinity toleranceMedium
Seed longevity index0
Shade toleranceLow
Soil pH max8 pH
Soil pH min5.5 pH
Specific leaf area (SLA)22.28 mm²/mg
Temperature min-28 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalHigh
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound11 360 per lb
ToxicityNone
Veneer productNo
Other traits6
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceNo
Inflorescencespike
03Chemical composition7 compounds
Compounds documented for Triticum aestivum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Flavones7
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 6-Methylscutellarein | present | NPASS | |
| Apigenin | present | NPASS | |
| Apigenin 7-O-glucuronide | present | NPASS | |
| Apiumetrin | present | NPASS | |
| Linarin | present | NPASS | |
| Luteolin 7-diglucoside | present | NPASS | |
| Tricin | present | NPASS |
05DNA & barcoding130 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Triticum aestivum has left across the world's sequence archives.
At a glance
DNA specimens130
Marker genes14
eDNA detections364
Countries10
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P1 575 bp consensus10 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.
Where individuals differ — all 2 variable positions, in barcode order
1551Tmostly conserved
1575Gvariable
ATGACAAATATGGTTCGATGGCTCTTCTCTACTAACCACAAGGATATTGGGACTCTCTATTTCATCTTCGGTGCCATTGCAGGAGTGATG …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)0.05%
Haplotypes3
BINs0
Most divergent pair0.13%
AsiaOther
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★matK-like★rbcL★rbcLa★ITS★ITS1★ITS2atp6COIICOXIIIatpF-atpHrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemitochondrialmarker
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_036024 ↗ · 36 protein · 22 tRNA · 9 rRNA
nad2atp1atp9nad1rp13atp6-1cox3rpl5nad5matRrps1ccmFNcobatp6-2rpl16rps3ccmFCnad4ccmCccmBatp4nad9rps2cox2atp8-2cox1+19
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB
The complete instruction manual Triticum aestivum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidypolyploid inferred
Chromosome records14–422n range42median42mode93records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4291×CCDB · iber-fl · CCDB · nw-europe-fl · CCDB · fl-europaea +12
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 77-103(1973).
CCDB · iber-fl — Estudo comparativo de cariotipos no gnero Triticum. Camara, A.Agron. Lusit.5(2): 95-117(1943).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4646
CCDB · fl-europaea — Camara &
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Chen, R. y. 1989. A further research of plant chromosome G-banding. Pp. 187--193 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Chen, S. y., J. Fu & L. z. Gao. 1985. The hybridization between Triticum aestivum and Elymus mollis. Acta Bot. Boreal.-Occid. Sin. 5(4): 260–266.
CCDB · ipcn-api-dl — Larik, A. S., K. A. Siddiqui & H. Larik. 1982. Persistence of chromosomal aberrations in mutated populations of Triticum aestivum. Cytologia 47: 247–256.
CCDB · ipcn-api-dl — Wang, Y. n., P. d. Chen & D. j. Liu. 1986. Transfer of useful germplasm from Elymus giganteus L. to common wheat I. Production of T. aestivum L. cv. Chinese Spring x Elymus giganteus F1. J. Nanjing Agric. Univ. 1: 10–14.
CCDB · ipcn-api-dl — Badaeva, E. D., F. M. Shkutina, N. Bogdevich & N. S. Badaev. 1986. Comparative study of Triticum aestivum and T. timopheevi genomes using C-banding technique. Pl. Syst. Evol. 154: 183–194.
CCDB · ipcn-api-dl — Kimber, G. & M. Feldman. 1987. Wild wheat[:] an introduction. Special Report. 353: 112–113. College of Agriculture, University of Missouri, Columbia.
CCDB · ipcn-api-dl — ENDO, T. R. 1986. Complete identification of common wheat chromosomes by means of the C-banding technique. Jap. J. Genet. 61: 89–93.
CCDB · ipcn-api-dl — Zhang, Z., G. Dong & P. Lu. 1982. Study on the chromosome N-banding in plants. Acta Bot. Sin. 24: 120–124.
CCDB · ipcn-api-dl — Yan, Y. & D. j. Liu. 1987. Production and cytogenetics of intergeneric hybrid between Roegneria ciliaris and Triticum aestivum. Sci. Agric. Sin. 20(6): 17–21.
CCDB · ipcn-api-dl — Semenov, V. I. 1986. Vnutrikhromosomnaja topografija geterokhromatina u zlakovykh. Bjulleten' Glavnogo Botanic|5eskogo Sada 140: 68–73.
CCDB · ipcn-api-dl — Izumi, N., S. Sawada & T. Sasakuma. 1983. Genetic analysis of dwarfness in Triticum aestivum L. cv. Ai-bian 1. Rep. Kihara Inst. Biol. Res. 31: 38–48.
CCDB · ipcn-api-dl — Zhang, Z. p., Y. m. Zhang & J. z. Yuan. 1990. A study of the chromosomes of Triticum aestivum and Hordeum distichon by silver staining. Acta Agric. Univ. Henan. 24: 82–85.
CCDB · ipcn-api-dl — Lu, B. r., J. Yan & J. l. Yang. 1990. Cytological observations on Triticeae materials from Xinjiang, Qinghai and Sichuan. Acta Bot. Yunnan. 12: 57–66.
CCDB · ipcn-api-dl — Oryol, L. I., R. A. Udachin, N. A. Agafonova & V. F. Ogorodnicova. 1990. Morphological and caryological features of Triticum petropavlovskyi (Poaceae). Bot. Žhurn. (Moscow & Leningrad) 75: 37–44.
CCDB · ipcn-api-dl — Limin, A. E. & D. B. Fowler. 1988. Cold hardiness expression in interspecific hybrids and amphiploids of the Triticeae. Genome 30: 361–365.
CCDB · ipcn-api-dl — Jahan, Q., N. Ter-Kuile, N. Hashmi, M. Aslam, A. A. Vahidy & A. Mujeeb-Kazi. 1990. The status of the IB/IR translocation chromosome in some released wheat varieties and the 1989 candidate varieties of Pakistan. Pakistan J. Bot. 22: 1–10.
CCDB · ipcn-api-dl — Shi, Y., J. Draper & C. Stace. 1993. Ribosomal DNA variation and its phylogenetic implication in the genus Brachypodium (Poaceae). Pl. Syst. Evol. 188: 125–138.
CCDB · ipcn-api-dl — Liu, J. w. & Y. c. Dong. 1995. Establishment of somaclones and regeneration of plant from Triticum aestivum x Eremopyrum orientale hybrid. Acta Genet. Sin. 22(2): 116–121.
CCDB · ipcn-api-dl — Li, D. w., J. w. Qiu, O. y. Ping & Q. x. Yao. 1994. Wide hybridization between Triticum aestivum and Tripsacum dactyloides. I. Frequency of embryo formation. Acta Genet. Sin. 21(5): 398–402.
CCDB · ipcn-api-dl — Li, H. j., R. Fang, B. h. Guo, Z. n. Wang & C. j. Pei. 1994. Cytological studies on F1 hybrids between hexaploid Aegilops and Triticum aestivum. Acta Bot. Sin. 36(9): 714–719.
CCDB · ipcn-api-dl — Jiang, J. & B. K. Gill. 1994. New 18S--26S ribosomal RNA gene loci: chromosomal landmarks for the evolution of polyploid wheats. Chromosoma 103: 189–195.
CCDB · ipcn-api-dl — Miller, T. E., N. Iqbal, S. M. Reader, A. Mahmood, K. A. Cant & I. P. King. 1997. A cytogenetic approach to the improvement of aluminium tolerance in wheat. New Phytol. 137: 93–98.
CCDB · ipcn-api-dl — Zhang, C. s. 1998. A preliminary study on making plant chromosomal specimens using peppermint oil compound as pretreatment agent. J. Wuhan Bot. Res. 16(3): 280–282.
CCDB · ipcn-api-dl — Qi, Z. j., H. g. Wang, Q. q. Li, J. r. Gao & G. t. Chen. 1998. Crossability of some wheat cultivars (lines) with rye and chromosome paring ability of their hybrids. J. Shandong Agric. Univ. 29(4): 435–442.
CCDB · ipcn-api-dl — Badea, E. M., A. Scripcariu, L. Gregorian & R. Gorenflot. 1999. Evaluation de la variabilité de somaclones de blé par l'étude de la meiose. Rev. Cytol. Biol. Vég., Bot. 22(1–2): 3–7.
CCDB · ipcn-api-dl — Papoglou, C. 1981. Spletoid mutants of Triticum aestivum studied by cytological and electrophoretic methods. Ber. Deutsch. Bot. Ges. 93: 689–700.
CCDB · ipcn-api-dl — Pienaar, R. d. V. 1979. Meiotic associations in a Triticum aestivom L. em. Thell. X Agropyron distichum (Thunb.) Beauv. hybrid. Wheat Inform. Serv. 49: 24–26.
CCDB · ipcn-api-dl — Romero, C. & J. R. Lacadena. 1980. Interaction between rye B-chromosomes and wheat genetic systems controlling homocologous pairing. Chromosoma 80: 33–48.
CCDB · ipcn-api-dl — Fatkhutdinova, R. A., F. M. Shakirova, A. V. Chemeris, B. E. Sabirzhanov & V. A. Vakhitov. 2002. NOR activity in wheat species with different ploidy levels treated with phytohormones. Genetika 38(11): 1575–1579.
CCDB · ipcn-api-dl — Pershina. 2005. Feature of crossability haploidy and polyembriony in hybrid combinations between common barley Hordeum vulgare L. (2n = 14) and wheat-ray substitution lines Triticum aestivum L. cultivar Saratovskaya 29/Secale cereale L., cultivar Onokhoiskaya. Genetika 41: 784–792.
CCDB · ipcn-api-dl — Silkova. 2006. Production of wheat-ray substitution lines and identification of chromosome composition of karyotypes using C-banding, GISH, and SSR markers. Genetika 42: 793–802.
CCDB · ipcn-api-dl — Chen, J. m., Z. l. Ren & J. P. Gustafson. 1996. Heterochromatin differentiation in Xizang cultivated and semi-wild wheat revealed by C-banding technique. Acta Agron. Sin. 22(5): 525–529.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang, Z. p. An, C. b. Chen, Z. x. Qi & Y. z. Sun. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 2, Chromosome Atlas of Crops and their Wild Kindred Plants in China Relatives. Science Press, Beijing.
CCDB · ipcn-api-dl — Xu, R. h. & Q. q. Zhang. 1996. Karyotype analysis of hybrid between Chinese Spring and Avena fatua L. SouthW. China J. Agric. Sci. 9(1): 33–38.
CCDB · ipcn-api-dl — Liu, J. y. 2004. A new chromosome fluorescence banding technique combining DAPI staining with image analysis in plants. Chromosoma 113: 16–21.
+42 more references
2n 412×CCDB · ipcn-api-dl · CCDB · book-indian_vol2
CCDB · ipcn-api-dl — Zhang, Z., G. Chen, L. Fu & N. Li. 1983. Chromosomal banding analysis of monosomics in wheat. Acta Bot. Sin. 25: 324–327.
CCDB · book-indian_vol2 — Romero, C. & Lacadena, J.R. 1980
2n 141×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Ganeva, G., B. Bochev & N. Bocheva. 1992. Variability of genome B somatic karyotype in Triticum aestivum L. Cytologia 57: 417–426.
2n 341×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Rao, V.R. & Murthy, B.R. 1972
n 2111×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Larik, A. S., K. A. Siddiqui & H. Larik. 1982. Persistence of chromosomal aberrations in mutated populations of Triticum aestivum. Cytologia 47: 247–256.
CCDB · ipcn-api-dl — Papoglou, C. 1981. Spletoid mutants of Triticum aestivum studied by cytological and electrophoretic methods. Ber. Deutsch. Bot. Ges. 93: 689–700.
CCDB · ipcn-api-dl — Pienaar, R. d. V. 1979. Meiotic associations in a Triticum aestivom L. em. Thell. X Agropyron distichum (Thunb.) Beauv. hybrid. Wheat Inform. Serv. 49: 24–26.
CCDB · ipcn-api-dl — Romero, C. & J. R. Lacadena. 1980. Interaction between rye B-chromosomes and wheat genetic systems controlling homocologous pairing. Chromosoma 80: 33–48.
CCDB · ipcn-api-dl — Koul, K. K., R. Nagpal & A. Sharma. 2000. Chromosome behaviour in the male and female sex mother cells of wheat (Triticum aestivum L.), oat (Avena sativa L.) and pearl millet (Pennisetum americanum (L.) Leeke). Caryologia 53: 175–183.
CCDB · ipcn-api-dl — Spies, J. J., T. H. Burger & S. M. C. v. Wyk. 1999. Chromosome studies on African plants. 12. The tribes of subfamily Pooideae. Bothalia 29(2): 335–341.
CCDB · ipcn-api-dl — Kato, T. & H. Yamagata. 1982. Effect of 3B chromosome deficiency on the meiotic pairing between the arms of an isochromosome in common wheat. Jap. J. Genet. 57: 403–406.
CCDB · ipcn-api-dl — Noguchi, J. & R. TANAKA. 1981. C-banding after aceto-orcein staining for plant chromosomes. Jap. J. Genet. 56: 529–532.
CCDB · book-ipcn67-71 — DRISCOLL, C.J., & L.N. BIELIG. 1968. Mapping of the Transec wheat-rye translocation. Canad. J. Genet. Cytol. 10: 421-425.
n 171×CCDB · book-ipcn72
CCDB · book-ipcn72 — RAO, V.R. & B.R. MURTH. 1972. Fractional diallel analysis of regulation of recombination in Triticum aestivum L. Cytologia 37: 83-93.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type123 307 records
Wild obs. + sensor94 455
Museum / vouchered17 243
Cultivated / captive6 651
Fossil10
Other4 948
Origin
Native204
Introduced6 386
Range
Area of Occupancy AOO251 176 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy76% within 1 km
≤100 m 48 487≤1 km 9 034≤10 km 17 946>10 km 435
75 902 georeferenced · 18 553 without coordinates
Open the mapobservation + sensor94 455
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy85% within 1 km
≤100 m 9 896≤1 km 1 399≤10 km 1 689>10 km 237
13 221 georeferenced · 4 022 without coordinates
Open the institutions mapphysical evidence17 243
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy11% within 1 km
≤1 km 64≤10 km 360>10 km 181
605 georeferenced · 6 046 without coordinates
Open the mapnot free-living6 651
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions240 of 412 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Centro Internacional de Mejoramiento de Maíz y Trigolocation not on record | 9 442 |
| Uniwersytet Wrocławskilocation not on record | 1 677 |
| ROM007location not on record | 308 |
| AUT001location not on record | 164 |
| HUN003location not on record | 155 |
| LDlocation not on record | 131 |
| BIO-UNIPIlocation not on record | 131 |
| Olocation not on record | 126 |
| Beijing, CN | 122 |
| Paris, FR | 119 |
| ESP004location not on record | 118 |
| Helsinki, FI | 116 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 106 |
| POL003location not on record | 77 |
| Riverside, US | 77 |
| Philadelphia, US | 70 |
| South Kensington, GB | 69 |
| Karlsruhe, DE | 67 |
| MeiseBGlocation not on record | 65 |
| Sichuan Agricultural Universitylocation not on record | 65 |
| Moscow State Universitylocation not on record | 62 |
| SWE054location not on record | 59 |
| Trondheim, NO | 57 |
| Oskarshamn, SE | 55 |
| Chongqing Museumlocation not on record | 51 |
| Provincia di Livornolocation not on record | 47 |
| SLU Artdatabankenlocation not on record | 46 |
| Wuzhou, CN | 44 |
| Claremont, US | 43 |
| San Diego, US | 43 |
| Canadian Department of Agriculturelocation not on record | 41 |
| Jyväskylä, FI | 41 |
| ASUlocation not on record | 39 |
| Spearfish, US | 39 |
| ARM059location not on record | 37 |
| Tartu, EE | 35 |
| Museo Entomologico de Leonlocation not on record | 35 |
| Flagstaff, US | 34 |
| Istituto Agrario Castelnuovolocation not on record | 34 |
| AZE015location not on record | 34 |
| Adelaide, AU | 33 |
| Allentown, US | 33 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 32 |
| Ann Arbor, US | 32 |
| Durango, MX | 31 |
| Madison, US | 31 |
| Brisbane, AU | 30 |
| KMNlocation not on record | 30 |
| International Salmonella Centre (W.H.O.)location not on record | 29 |
| Sanda, JP | 28 |
| Odawara, JP | 27 |
| Santa Barbara, US | 26 |
| WTUlocation not on record | 26 |
| Bern, CH | 26 |
| Bronx, US | 26 |
| Oulu, FI | 26 |
| Bergen, NO | 25 |
| Saint Louis, US | 25 |
| San Luis Obispo, US | 25 |
| Xinxiang, CN | 25 |
| Kuopio, FI | 24 |
| Mount Annan, AU | 24 |
| Davis, US | 24 |
| Canberra, AU | 23 |
| Québec, CA | 23 |
| Emporia, US | 22 |
| ROM023location not on record | 21 |
| University of Stellenboschlocation not on record | 21 |
| Pullman, US | 21 |
| Kensington, AU | 20 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 20 |
| TROMlocation not on record | 20 |
| BRNUlocation not on record | 18 |
| Denver, US | 18 |
| College of the Atlantic, Museumlocation not on record | 18 |
| Austin, US | 17 |
| Uniwersytet Warszawskilocation not on record | 16 |
| Dresden, DE | 16 |
| US | 16 |
| Philadelphia, US | 16 |
| Fort Worth, US | 16 |
| Yangling, CN | 16 |
| Auckland, NZ | 16 |
| TUR-Alocation not on record | 16 |
| València, ES | 15 |
| GMBAlocation not on record | 15 |
| Corvallis, US | 15 |
| EL PASO, US | 15 |
| Guangzhou, CN | 15 |
| Logan, US | 15 |
| Wuhan, CN | 15 |
| Mlocation not on record | 15 |
| Hobart, AU | 15 |
| Görlitz, DE | 14 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 14 |
| BAYLUlocation not on record | 14 |
| MAlocation not on record | 14 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 14 |
| Missoula, US | 13 |
| Guilin, CN | 13 |
| St. Paul, US | 13 |
| CASlocation not on record | 13 |
| TAIElocation not on record | 13 |
| Christchurch, NZ | 13 |
| QAUlocation not on record | 13 |
| Baroda, IN | 12 |
| Vancouver, CA | 12 |
| BFLlocation not on record | 12 |
| Mexico City, MX | 12 |
| Córdoba, AR | 12 |
| Bloomington, US | 12 |
| Université Lavallocation not on record | 12 |
| BDBClocation not on record | 12 |
| Chadron, US | 11 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 11 |
| Burlington, US | 11 |
| Zhengzhou, CN | 11 |
| Williamsburg, US | 11 |
| Pittsburg, US | 10 |
| Arcata, US | 10 |
| Irvine, US | 10 |
| Tula State Universitylocation not on record | 10 |
| IDElocation not on record | 10 |
| Millersville, US | 10 |
| Chicago, US | 10 |
| Barcelona, ES | 9 |
| Victoria, CA | 9 |
| Tampa, US | 9 |
| Irkutsk State Universitylocation not on record | 9 |
| Taipei, TW | 9 |
| College Park, US | 9 |
| Turku, FI | 9 |
| Bangkok, TH | 9 |
| University of New Hampshirelocation not on record | 9 |
| Armidale, AU | 8 |
| Badajoz, ES | 8 |
| Jackson, US | 8 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Garðabær, IS | 8 |
| Bozeman, US | 7 |
| Fayetteville, US | 7 |
| Tuscaloosa, US | 7 |
| Chiba, JP | 7 |
| Cheney, US | 7 |
| Porvoo, FI | 7 |
| Universidad de Caldas (UCaldas)location not on record | 7 |
| BClocation not on record | 7 |
| DBF-NHMDlocation not on record | 7 |
| Guasave, MX | 7 |
| GBR016location not on record | 7 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 7 |
| Columbia, US | 7 |
| Boise, US | 6 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 6 |
| Uppsala, SE | 6 |
| Palmerston, AU | 6 |
| Wuhan, CN | 6 |
| GJOlocation not on record | 6 |
| Albuquerque, US | 6 |
| Xiamen, CN | 6 |
| Moscow, US | 6 |
| Madrid, ES | 6 |
| Pamplona, ES | 6 |
| Clemson, US | 6 |
| Kochi, JP | 6 |
| Mexico City, MX | 6 |
| Xining, CN | 6 |
| Salvador, BR | 5 |
| University of Alberta Museumslocation not on record | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Zürich, CH | 5 |
| Yaoundé, CM | 5 |
| Nanjing, CN | 5 |
| University of Winnipeglocation not on record | 5 |
| Frauenfeld, CH | 5 |
| Entomological Society of Latvialocation not on record | 5 |
| Tempe, US | 5 |
| Zapopan, MX | 5 |
| Parthenon Tama History Museumlocation not on record | 5 |
| Acadia Universitylocation not on record | 5 |
| Tokushima, JP | 5 |
| Portland, US | 5 |
| Kew, GB | 5 |
| Los Angeles, US | 4 |
| Tsukuba, JP | 4 |
| Montecillo, Texcoco, MX | 4 |
| Northridge, US | 4 |
| Henderson State Universitylocation not on record | 4 |
| Tapachula, MX | 4 |
| USFSlocation not on record | 4 |
| Chapingo, MX | 4 |
| Nagano City, JP | 4 |
| Jena Microbial Resource Collectionlocation not on record | 4 |
| Tlalnepantla, MX | 4 |
| Hazara Universitylocation not on record | 4 |
| Norfolk, US | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Berlin, DE | 4 |
| Phoenix, US | 4 |
| Kushiro City Museumlocation not on record | 4 |
| GZUlocation not on record | 4 |
| Muzaffarabad, PK | 4 |
| Tianjin Natural History Museumlocation not on record | 4 |
| Otaru, JP | 4 |
| Ensenada, MX | 4 |
| Edmonton, CA | 4 |
| Salamanca, ES | 4 |
| Anchorage, US | 4 |
| Tilburg, NL | 4 |
| Wellington, NZ | 4 |
| Chapel Hill, US | 3 |
| Salzburg, AT | 3 |
| Stockholm, SE | 3 |
| UChlocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Lincoln, US | 3 |
| 3 | |
| Inner Mongolia Universitylocation not on record | 3 |
| Grand Junction, US | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Provo, US | 3 |
| UFBAlocation not on record | 3 |
| Urumqi, CN | 3 |
| University of Southern Mississippilocation not on record | 3 |
| Sagamihara, JP | 3 |
| Whitehorse, CA | 3 |
| Toronto, CA | 3 |
| Knoxville, US | 3 |
| Pocatello, US | 3 |
| UTFPR-DVlocation not on record | 3 |
| Montréal, CA | 3 |
| Nishihara, JP | 3 |
| Little Rock, US | 3 |
| Chengdu, CN | 3 |
| Texas A&M Universitylocation not on record | 3 |
| Toluca, MX | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Lanzhou, CN | 3 |
| Alicante, ES | 3 |
| Culiacán, MX | 3 |
| Hiratsuka City Museumlocation not on record | 2 |
| Cambridge, US | 2 |
| Portland, US | 2 |
| Staten Island, US | 2 |
| Tacoma, US | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Henderson, US | 2 |
| Miami, US | 2 |
| Cenargenlocation not on record | 2 |
| Göteborg, SE | 2 |
| Bourges, FR | 2 |
| nbflocation not on record | 2 |
| Seoul, KR | 2 |
| Tomioka, JP | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| nlocation not on record | 2 |
| Awka, NG | 2 |
| Valdosta State Universitylocation not on record | 2 |
| Richmond, US | 2 |
| Orem, US | 2 |
| Porrentruy, CH | 2 |
| Davenport, US | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| San Angelo, US | 2 |
| California Academy of Scienceslocation not on record | 2 |
| Brasília, BR | 2 |
| GB | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Jataí / Setor Industrial, BR | 2 |
| Whitewater, US | 2 |
| BGR001location not on record | 2 |
| Wlocation not on record | 2 |
| Hangzhou, CN | 2 |
| PUC-RSlocation not on record | 2 |
| SZUlocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Capital Normal Universitylocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Zürich, CH | 2 |
| Brussel, BE | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Saint John, CA | 2 |
| TAFORI-LSRClocation not on record | 2 |
| Guatemala City, GT | 2 |
| Hermosillo, MX | 2 |
| Lubbock, US | 2 |
| Universidade Tecnológica Federal do Paranálocation not on record | 2 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 |
| SIHUlocation not on record | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Durban, ZA | 2 |
| PRClocation not on record | 2 |
| Akita Prefectural Museumlocation not on record | 2 |
| La Trobe Universitylocation not on record | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| UEMlocation not on record | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Bando, JP | 1 |
| Rotorua, NZ | 1 |
| The University of Arizonalocation not on record | 1 |
| San José, CR | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Taipei, TW | 1 |
| Granada, ES | 1 |
| Caldwell, US | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Minia, EG | 1 |
| Green Bay, US | 1 |
| Chicago, US | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Northeastern Forestry Universitylocation not on record | 1 |
| Shenzhen, CN | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| New Haven, US | 1 |
| Bend, US | 1 |
| Pamplona, ES | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| US | 1 |
| San Isidro, AR | 1 |
| La Paz, MX | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| AASlocation not on record | 1 |
| Oswego, US | 1 |
| Torreón, MX | 1 |
| Coimbra, PT | 1 |
| Chicago, US | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Macomb, US | 1 |
| Vitoria, ES | 1 |
| STNFlocation not on record | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Criciúma, BR | 1 |
| Bothell, US | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Santa Cruz, US | 1 |
| UNESClocation not on record | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Sion, CH | 1 |
| Fulda, DE | 1 |
| Pretoria, ZA | 1 |
| BGPAlocation not on record | 1 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| US | 1 |
| Ashland, US | 1 |
| GAlocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Juriquilla, MX | 1 |
| AUAlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| Mérida, MX | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| Honolulu, US | 1 |
| La Paz, BO | 1 |
| Philadelphia, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| KMCClocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Jaén, ES | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Dekalb, US | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| NLD037location not on record | 1 |
| Fairfax, US | 1 |
| CZE122location not on record | 1 |
| Austin, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Zacatecas, MX | 1 |
| Gijón, ES | 1 |
| Mount Berry, US | 1 |
| Brasília, BR | 1 |
| Aarhus, DK | 1 |
| IFR-DNFlocation not on record | 1 |
| NSW Office of Environment and Heritagelocation not on record | 1 |
| CJBGlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Montréal, CA | 1 |
| ROM001location not on record | 1 |
| AZE003location not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Toyama, JP | 1 |
| Keene State Universitylocation not on record | 1 |
| Rovaniemi, FI | 1 |
| UIBlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| McGill Universitylocation not on record | 1 |
| Dehra Dun, IN | 1 |
| VALElocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| UNESP-ISlocation not on record | 1 |
| New Brunswick, US | 1 |
| San Jose, US | 1 |
| Palmerston North, NZ | 1 |
| UNIVILLElocation not on record | 1 |
| Durango, US | 1 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| KIRMlocation not on record | 1 |
| JBSlocation not on record | 1 |
412 institutions · 16 434 of 17 243 vouchered records shown · 673 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA364 detections
Where the DNA of Triticum aestivum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found364
Studies independent surveys3
Countries10
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 364 detections have coordinates
Open the map10 countries0
Pine-Oak woodland; Bromus carinatus, Elymus …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature18.0 °C 0.997–30.6
pH8.06 7.26–9.30
Conductivity47,444 µS/cm 27,000–58,526
Salinity35.4 PSU 16.6–36.4
Dissolved oxygen7.95 mg/L 1.99–11.2
Turbidity0.396 NTU 0–16.1
Nitrate0.85 µmol/L 0.1–13.1
Depth10.0 m 0–5,200
Coastal waterPelagicSediment
237 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.8 °C 10.4–21.9
Seasonal swing summer↔winter7.00 °C
Max temp (day)18.2 °C 14.2–24.0
Min temp (night)13.8 °C 4.50–20.2
Precipitation61.6 mm/mo 26.4–127
Air humidity58.3 % 54.3–61.4
Vapour deficit754 Pa 600–1,095
Cloud cover26.9 % 16.1–45.7
CHELSA 1981–2010, ~9 km grid, at location & month of 302 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.