Trithuria submersa

Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Nymphaeales/Hydatellaceae/Trithuria

At a glance

Occurrence records386

Data sources8

Biological traits32

DNA specimens17

eDNA detections17

Sources8 archives

Databases and archives Trithuria submersa's data was compiled from.

GBIFGlobal Biodiversity Information Facility386 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF386 records

Environmental DNA1 datasets · 0 countries17 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceCCDB · GoaT1.3 Gbp

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length0.55 mm

Leaf length25 mm

Leaf size23.56 mm²

Leaf width1 mm

Plant height0.08 m

Plant height max0.08 m

Seed length0.4 mm

Seed mass0.058 mg

Seed width0.2 mm

Life cycle & reproduction10

Dispersal typeanimal+self

Flowering endDec

Flowering startNov

Flowering timennnnnnnnyyyn

Life formannual

Life spanannual

Pollination syndromewind

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticaquatic

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Aquatic

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trithuria submersa has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes3

GenBank sequences10

eDNA detections17

The DNA barcodea real sequence read deposited for this species

rbcLJQ284257.1 ↗540 bp

ACGT

ATTGGATTCAAAGCCGGTGTTAAAGATTACAGATTGACTTATTACACTCCTGAGTATGTAACCCTTGATACTGATATCTTGGCAGCATTC …

Trithuria submersa voucher Sandiford 902 (PERTH) 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Trithuria submersa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 339 860 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Trithuria submersa1.34 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Chromosome records56–562n range56median56mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 562×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Kynast RG, Joseph JA, Pellicer J, Ramsay MM, Rudall PJ. 2014. Chromosome behavior at the base of the angiosperm radiation: Karyology of Trithuria submersa (Hydatellaceae, Nymphaeales). American Journal of Botany 101: 1447-1455.

08Occurrence & distribution

Record type386 records

Wild obs. + sensor180

Museum / vouchered206

Origin

Native30

Range

Area of Occupancy AOO1 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 81≤1 km 63≤10 km 31>10 km 3

178 georeferenced · 2 without coordinates

Open the mapobservation + sensor180

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 29≤1 km 25≤10 km 89>10 km 27

170 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	77
Kensington, AU	49
Adelaide, AU	35
Hobart, AU	18
Mount Annan, AU	11
Canberra, AU	6
Parkville, AU	2
QVMAGlocation not on record	2
EL PASO, US	1
Boise, US	1
Brisbane, AU	1
Kew, GB	1
BGPAlocation not on record	1

13 institutions · 205 of 206 vouchered records shown · 1 without an institution code

09Environmental DNA17 detections

Where the DNA of Trithuria submersa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)