Trithuria bibracteata

Stapf ex D.A.Cooke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Nymphaeales/Hydatellaceae/Trithuria

At a glance

Occurrence records101

Data sources5

Biological traits22

DNA specimens9

eDNA detections9

Sources5 archives

Databases and archives Trithuria bibracteata's data was compiled from.

GBIFGlobal Biodiversity Information Facility101 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF101 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Fruit length0.5 mm

Leaf length6 mm

Leaf width0.4 mm

Plant height0.02 m

Plant height max0.02 m

Seed length0.4 mm

Life cycle & reproduction5

Flowering timennnnnnnnyynn

Life formannual

Life spanannual

Raunkiær life formtherophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticaquatic

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Aquatic

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trithuria bibracteata has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences9

eDNA detections9

The DNA barcodea real sequence read deposited for this species

ITSJQ284180.1 ↗660 bp

ACGT

AACCTGCGGAAGGATCATTGTCGTGACCCTTCGACCGACCCGTGAACTCGTGAACGGATGCTTTGCCGACCGTCGCGGCTCGACGCTCCG …

Trithuria bibracteata voucher Keighery B.J. & Gibson 801 (PERTH) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type101 records

Wild obs. + sensor35

Museum / vouchered66

Origin

Native2

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 23≤1 km 12

35 georeferenced

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 21≤1 km 1≤10 km 17>10 km 1

40 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	61
Mount Annan, AU	2
Moscow State Universitylocation not on record	1
Brisbane, AU	1
Canberra, AU	1

5 institutions · 66 of 66 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Trithuria bibracteata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)