Triteleia bridgesii

(S.Watson) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Triteleia

At a glance

Occurrence records711

Data sources11

Biological traits10

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Triteleia bridgesii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility711 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF711 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

The triplet lily Triteleia bridgesii (previously Brodiaea bridgesii) is known by the common name Bridges' brodiaea. It is found in the foothills and low elevation mountains of California and Oregon, often in areas of serpentine soil. It is an attractive perennial flower often planted as an ornamental. The plant sends up long, erect green stems which branch near the top into several smaller stems which bear the blooms. The flowers are bright purple or lavender, tubular at first and then opening into six-pointed star shapes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition3 compounds

Compounds documented for Triteleia bridgesii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
3-oxo-3-[[(2S,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[7-hydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[3-(4-hydroxyphenyl)prop-2-enoyloxymethyl]oxan-2-yl]oxy-2-(3,4,5-trihydroxyphenyl)chromenylium-5-yl]oxyoxan-2-yl]methoxy]propanoic acid	present	LOTUS
3-oxo-3-[[(2S,3S,4S,5S,6S)-3,4,5-trihydroxy-6-[7-hydroxy-3-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-[3-(4-hydroxyphenyl)prop-2-enoyloxymethyl]oxan-2-yl]oxy-2-(3,4,5-trihydroxyphenyl)chromenylium-5-yl]oxyoxan-2-yl]methoxy]propanoic acid	present	LOTUS
[(2R,3S,4S,5S,6S)-3,4,5-trihydroxy-6-[7-hydroxy-5-[(2S,3R,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-(3,4,5-trihydroxyphenyl)chromenylium-3-yl]oxyoxan-2-yl]methyl (E)-3-(4-hydroxyphenyl)prop-2-enoate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Triteleia bridgesii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLZ69198.1 ↗1 341 bp

ACGT

AAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACTAAAGATACTGATATTTTGGCAGC …

T.bridgesii chloroplast rbcL gene

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Triteleia bridgesii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type711 records

Wild obs. + sensor457

Museum / vouchered253

Cultivated / captive1

Origin

Native4

Range

Area of Occupancy AOO1 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 229≤1 km 60≤10 km 19>10 km 22

330 georeferenced · 127 without coordinates

Open the mapobservation + sensor457

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 7≤1 km 86≤10 km 42>10 km 7

142 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence253

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Angwin, US	52
Arcata, US	47
Corvallis, US	42
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	24
San Diego, US	7
WTUlocation not on record	6
Claremont, US	5
Santa Barbara, US	4
Bronx, US	4
Ashland, US	4
Logan, US	4
Turlock, US	4
Riverside, US	2
Beijing, CN	2
Pullman, US	2
Canadian Department of Agriculturelocation not on record	2
US	1
Pomona Collegelocation not on record	1
Davis, US	1
Provo, US	1
Boise, US	1
San Luis Obispo, US	1
Moscow, US	1
Wuzhou, CN	1
Vancouver, CA	1

25 institutions · 220 of 253 vouchered records shown · 33 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Triteleia bridgesii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)