Trite auricoma

(Urquhart, 1886) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Trite

At a glance

Occurrence records938

Data sources8

Biological traits0

DNA specimens22

eDNA detections22

Sources8 archives

Databases and archives Trite auricoma's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility938 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF938 records

Environmental DNA1 datasets · 1 countries22 detections

DNA & barcodingBOLD22 specimens

01Narrative

Trite auricoma, commonly known as the golden-brown jumping spider, is a species of jumping spider endemic to New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trite auricoma has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections22

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

8Tmostly conserved

9Amostly conserved

13Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

20Gmostly conserved

23Gmostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Gmostly conserved

33Cmostly conserved

34Tmostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

39Tmostly conserved

40Gmostly conserved

42Gmostly conserved

45Cmostly conserved

46Tmostly conserved

47Gmostly conserved

48Cmostly conserved

50Amostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

55Tmostly conserved

56Gmostly conserved

59Tmostly conserved

60Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Amostly conserved

70Amostly conserved

72Amostly conserved

73Gmostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Cmostly conserved

81Amostly conserved

82Gmostly conserved

84Cmostly conserved

86Gmostly conserved

87Gmostly conserved

88Amostly conserved

89Amostly conserved

90Amostly conserved

91Tmostly conserved

118Cvariable

349Gmostly conserved

568Tvariable

AACTTTATATTTAGTTTTTGGAGTTTGATCGGCTATAGTGGGTACTGCTATAAGTGTTTTAATTCGAATAGAGTTGGGACAGACTGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes3

BIN1

Most divergent pair0.61%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Myrmaplata plataleoidessame family10.4%Heliophanus pygmaeussame family10.9%Myrmarachne solitariasame family11.1%Icius hamatussame family11.7%Heliophanus auratussame family11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type938 records

Wild obs. + sensor930

Museum / vouchered8

Range

Area of Occupancy AOO1 760 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 427≤1 km 177≤10 km 74>10 km 65

743 georeferenced · 187 without coordinates

Open the mapobservation + sensor930

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 1≤1 km 4≤10 km 1

6 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	8

1 institutions · 8 of 8 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Trite auricoma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map1 country0

ForestFreshwater Lake

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 14.8–17.4

Seasonal swing summer↔winter9.80 °C

Max temp (day)18.7 °C 18.4–21.0

Min temp (night)12.9 °C 10.5–13.2

Precipitation97.9 mm/mo 91.5–111

Air humidity61.3 % 60.4–61.9

Moisture balance0.2 mm/mo -21.1–17.8

Vapour deficit696 Pa 647–786

Wind speed3.70 m/s 3.50–4.60

Cloud cover36.2 % 36.0–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)