Tristaniopsis laurina

(Sm.) Paul G.Wilson & J.T.Waterh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Tristaniopsis

At a glance

Occurrence records4 057

Data sources10

Biological traits49

DNA specimens10

eDNA detections8

Sources10 archives

Databases and archives Tristaniopsis laurina's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 057 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources49 traits

Occurrence & distributionGBIF4 057 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Tristaniopsis laurina, the water gum or kanooka, is a tree species native to Australia. It usually grows near the eastern coastline and along the banks of streams, where the trunks and branches tend to be shaped in the direction of the current and give an indication of the flood height.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology18

Fruit length6 mm

Fruit width5.5 mm

Leaf length120 mm

Leaf length max120 mm

Leaf length min65 mm

Leaf mass458 mg

Leaf mass per area147 g/m2

Leaf size1 364 mm²

⚠ sources differ — TRY: 1 364 mm² · AusTraits: 2 984 mm²

Leaf width30 mm

Leaf width max30 mm

Leaf width min15 mm

Petiole length0.55 cm

Plant height15 m

⚠ sources differ — GIFT: 15 m · AusTraits: 30 m

Plant height max30 m

Plant height min2 m

Seed length5 mm

Seed mass1.36 mg

⚠ sources differ — TRY: 1.36 mg · AusTraits: 1.16 mg

Seed width1.76 mm

Life cycle & reproduction14

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typewind

Flowering endJan

Flowering startDec

Flowering timeynnnnnnnnnny

Life formtree

Life span>100

⚠ sources differ — TRY: >100 · AusTraits: perennial · GIFT: perennial

Lifespan years100 years

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapenarrowly_oblanceolate oblanceolate

Woodinesswoody

Physiology & chemistry5

Leaf dry-matter content (LDMC)481 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.76 mm²/mg

Wood density812 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tristaniopsis laurina has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK397439.1 ↗648 bp

ACGT

TGCGGAAGGATCATTGTCGAATCCTGCCTAGCAGAATGACCAGAGAACTAGTAAAAAACTCAACGGGGTCGGTGGGCCTTGTCCCACCGC …

Tristaniopsis laurina isolate T17_00582/MR21-C6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL1★rbcLa★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tristaniopsis laurina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-fedorov

CCDB · book-fedorov — Smith-White 1948a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 057 records

Wild obs. + sensor3 455

Museum / vouchered534

Cultivated / captive5

Other63

Origin

Native138

Introduced17

Range

Area of Occupancy AOO9 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 2 517≤1 km 406≤10 km 130>10 km 28

3 081 georeferenced · 374 without coordinates

Open the mapobservation + sensor3 455

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 56≤1 km 92≤10 km 165>10 km 62

375 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence534

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2≤10 km 1

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	140
Museo Entomologico de Leonlocation not on record	107
Canberra, AU	75
Brisbane, AU	58
Armidale, AU	30
Auckland, NZ	19
Adelaide, AU	14
Parkville, AU	13
Rotorua, NZ	13
Christchurch, NZ	11
Batemans Bay, AU	10
Kew, GB	5
Smithfield, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	5
Riverside, US	4
Canadian Department of Agriculturelocation not on record	3
La Trobe Universitylocation not on record	3
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Palmerston, AU	2
John T. Waterhouse Herbariumlocation not on record	1
Hobart, AU	1
Northridge, US	1
Wollongong, AU	1
CASlocation not on record	1
Honolulu, US	1
Bronx, US	1
ASUlocation not on record	1
Turlock, US	1

28 institutions · 528 of 534 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Tristaniopsis laurina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter11.1 °C

Max temp (day)21.6 °C

Min temp (night)12.9 °C

Precipitation105 mm/mo

Air humidity61.1 %

Moisture balance-5.80 mm/mo

Vapour deficit759 Pa

Wind speed2.90 m/s

Cloud cover25.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tristaniopsis laurina

At a glance

Sources10 archives

Size & morphology18

Life cycle & reproduction14

Diet & foraging1

Habitat & environment10

Physiology & chemistry5

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 057 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 28 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 057 records