Tristaniopsis collina

Peter G.Wilson & J.T.Waterh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Tristaniopsis

At a glance

Occurrence records1 319

Data sources8

Biological traits44

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Tristaniopsis collina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 319 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Occurrence & distributionGBIF1 319 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Tristaniopsis collina, known as hill water gum or hill kanuka, is a tree of eastern Australia. The natural range of T. collina is from near Mount Gulaga (36° S) in the south of New South Wales to the border with the state of Queensland at the McPherson Range (28° S). The usual habitat is rainforest away from streams on shallow soils at high altitude. However, it can occasionally be seen at low altitudes such as at Seal Rocks and Chatswood West. T. collina is remarkably similar to the related T. laurina (Water Gum), but the latter species is strictly riparian.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology17

Fruit length6 mm

Fruit width5.5 mm

Leaf length65 mm

Leaf length max95 mm

Leaf length min40 mm

Leaf mass111 mg

Leaf mass per area122 g/m2

Leaf size906 mm²

Leaf width20.2 mm

Leaf width max25 mm

Leaf width min10 mm

Petiole length0.4 cm

Plant height35 m

⚠ sources differ — AusTraits: 35 m · TRY: 7 m

Plant height max30 m

Seed length4 mm

Seed mass0.938 mg

Seed width1.5 mm

Life cycle & reproduction13

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typewind

Flowering endJan

Flowering startDec

Flowering timeynnnnnnnnnny

Life formtree

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)8.17 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tristaniopsis collina has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKKM894817.1 ↗698 bpAustralia

ACGT

ACGTTTCTTTCTCCACGAGTATTGGAATAGTCTTATTACTCCAAAGAAACATATTACCTTTTTTTCAAAAGGTAATCCAAGATTATTCTT …

Tristaniopsis collina voucher 1076420531 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type1 319 records

Wild obs. + sensor1 070

Museum / vouchered243

Cultivated / captive2

Other4

Origin

Native92

Range

Area of Occupancy AOO3 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 980≤1 km 52≤10 km 19>10 km 3

1 054 georeferenced · 16 without coordinates

Open the mapobservation + sensor1 070

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 24≤1 km 54≤10 km 106>10 km 20

204 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence243

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	92
Canberra, AU	50
Brisbane, AU	29
Museo Entomologico de Leonlocation not on record	13
Batemans Bay, AU	12
Armidale, AU	8
Adelaide, AU	6
Wollongong, AU	5
John T. Waterhouse Herbariumlocation not on record	4
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Kew, GB	4
Smithfield, AU	3
Hobart, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Auckland, NZ	1
Palmerston, AU	1
Universidade Federale do Rio Grande do Sullocation not on record	1

17 institutions · 236 of 243 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Tristaniopsis collina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 20.8–20.8

Seasonal swing summer↔winter7.50 °C

Max temp (day)22.2 °C

Min temp (night)19.5 °C

Precipitation128 mm/mo

Air humidity59.1 %

Vapour deficit1,009 Pa

Cloud cover25.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tristaniopsis collina

At a glance

Sources8 archives

Size & morphology17

Life cycle & reproduction13

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Record type1 319 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 319 records