Trisetum flavescens
(L.) P.Beauv. · speciesAt a glance
Occurrence records248 677
Data sources13
Biological traits49
DNA specimens35
eDNA detections20
Sources13 archives
Databases and archives Trisetum flavescens's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility248 677 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics35 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources49 traits
Chemical compositionLOTUS · NPASS64 compounds
Occurrence & distributionGBIF248 677 records
Environmental DNA2 datasets · 5 countries20 detections
DNA & barcodingBOLD · NCBI35 specimens
Genome at a glanceCCDB · GoaT2.8 Gbp
01Narrative
Trisetum flavescens, the yellow oatgrass or golden oat grass, is a species of grass in the family Poaceae. It is native to Europe, Asia, and North Africa. It can be found elsewhere, such as sections of North America, where it was introduced as a rangeland grass for grazing.Grass Manual Treatment It now exists in the wild as a common weed.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology12
Leaf length115 mm
Leaf mass19.46 mg
Leaf size478 mm²
⚠ sources differ — TRY: 478 mm² · LEDA: 386 mm² · GIFT: 385 mm²
Leaf width2 mm
Plant height0.45 m
⚠ sources differ — GIFT: 0.45 m · AusTraits: 0.6 m · LEDA: 0.55 m · TRY: 0.53 m
Plant height generative0.712 m
Plant height max1 m
Plant height min0.2 m
Seed length1.32 mm
Seed mass0.353 mg
⚠ sources differ — TRY: 0.353 mg · LEDA: 0.245 mg · GIFT: 0.363 mg
Seed mass max0.59 mg
Seed mass min0.18 mg
Life cycle & reproduction14
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flowering endAug
Flowering startJun
Flowering timennnnnnnnyyyn
Life formperennial
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number12 609
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
⚠ sources differ — AusTraits: caryopsis · GIFT: nut
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: graminoid
Habitat GIFTforest, meadows: dry
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio16.63 g/g
Leaf c444 mg/g
Leaf dry-matter content (LDMC)319 mg/g
Leaf n28.77 mg/g
Leaf p1.29 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)24.93 mm²/mg
⚠ sources differ — TRY: 24.93 mm²/mg · LEDA: 20.8 mm²/mg · GIFT: 20.73 mm²/mg
Wood density93.73 mg/cm³
Other traits1
Diaspore typegenerative dispersule
03Chemical composition64 compounds
Compounds documented for Trisetum flavescens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cycloeudesmane sesquiterpenoids15
Eudesmane sesquiterpenoids5
Cycloeudesmane sesquiterpenoids $ Eudesmane sesquiterpenoids4
Labdane diterpenoids4
Norlabdane diterpenoids3
Documented compounds64 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1aR,4R,4aR,7S,7aS,7bR)-Decahydro-1,1,4,7-tetramethyl-1H-cycloprop(e)azulene-4,7-diol | present | NPASS | |
| (1R,4aS,5S,8aR)-5-(hydroxymethyl)-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,2S,4S,5S,7R,8S,9R,10S,16R,28E,33S,34S,36R,37R)-4,9,10,33-tetrahydroxy-1,8,13,28-tetramethyl-11,17,21,26,31-pentaoxadecacyclo[17.17.3.14,8.02,16.05,7.010,14.016,39.033,37.034,36.015,40]tetraconta-13,15(40),19(39),28-tetraene-12,18,22,25,30-pentone | present | NPASS | |
| (1S,4aR,5S,8aR)-5-[(E)-5-hydroxy-3-methyl-2-oxopent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,4aR,5S,8aR)-5-[(E,2R)-2,5-dihydroxy-3-methylpent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,4aR,5S,8aR)-5-[(E,2S)-2,5-dihydroxy-3-methylpent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,4aS,5R,8aS)-5-[(E,2R)-2-hydroxy-5-methoxy-3-methylpent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,4S,5E,7S)-4-methyl-10-methylidene-7-propan-2-ylcyclodec-5-ene-1,4-diol | present | NPASS | |
| (4aR,5R,8aR)-3,5,8a-trimethyl-4,4a,6,7,8,9-hexahydrobenzo[f][1]benzofuran-5-ol | present | NPASS | |
| (4aR,5R,8aR,9aR)-5-hydroxy-3,5,8a-trimethyl-4a,6,7,8,9,9a-hexahydro-4H-benzo[f][1]benzofuran-2-one | present | NPASS |
05DNA & barcoding35 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trisetum flavescens has left across the world's sequence archives.
At a glance
DNA specimens35
Marker genes6
GenBank sequences10
eDNA detections20
Countries6
The DNA barcodea real sequence read deposited for this species
TGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCAGCCCGCCGAGCGGTCCGCCGCTCGGCCA …
Trisetum flavescens subsp. flavescens voucher W. N. Koelz 16514 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★ITS9★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Trisetum flavescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 816 640 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trisetum flavescens2.82 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records12–402n range28median28mode41records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2815×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · brit-fl — Dixon, J.M. J. Ecol. 83: 895-909 (1995)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4523
CCDB · fl-europaea — Maj ovsky et al.,
CCDB · poland — Frey L. 1992. Taxonomy, karyology and distribution of the selected genera of tribe Avenae (Poaceae) in Poland. II Trisetum. - Fragm. Flor. Geobot. 37(2): 443-475.
CCDB · ipcn-api-dl — Sorokin, S. N. 1990. Chromosome numbers in members of the Poaceae family from the north-west of the European part of the USSR. Bot. Žhurn. (Moscow & Leningrad) 75: 1185.
CCDB · ipcn-api-dl — Sorokin, S. N. 1993. Karyosystematic study of some members of the tribe Aveneae (Poaceae). Bot. Žhurn. (Moscow & Leningrad) 78(4): 36–47.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-ipcn73-74 — POGOSYAN, A. I. 1974. Chromosome numbers in some species of flower inl' plants from the flora of the Aragatz Mountain Massif. (in Russian) Tsitologiya i Genetika 8: 449-451. I
CCDB · book-indian_vol2 — Hubbard, C.E. 1954 ; Bowden, W .M. 1960b
CCDB · book-indian_vol2 — Pogosyan, A.l. 1974
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1981a). Karyological studies on Bulgarian Poaceae . Bol. Soc. Brot. 53: 1161-1175.
CCDB · CromoCat 2015 — Sorokin, S.N. (1990). Chromosome numbers in members of the Poaceae family from the north-west of the European part of the USSR. Bot. Zurn. 75:1185
CCDB · CromoCat 2015 — Sorokin, S.N. (1993). Karyosistematic study of some members of the tribe Aveneae (Poaceae). Bot. Zurn. 78(4):36-47
2n 2412×CCDB · slov-fl · CCDB · poland · CCDB · ipcn-api-dl +3
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · poland — Frey L. 1992. Taxonomy, karyology and distribution of the selected genera of tribe Avenae (Poaceae) in Poland. II Trisetum. - Fragm. Flor. Geobot. 37(2): 443-475.
CCDB · ipcn-api-dl — Frey, L. 1993. Taxonomy, karyology and distribution of selected genera of tribe Aveneae (Poaceae) in Poland. IV. Conclusions. Fragm. Florist. Geobot. Suppl. 2(1): 279–288.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Frey, L. 1992. Taxonomy, karyology and distribution of the selected genera of tribe Aveneae (Poaceae) in Poland: II. Trisetum. Fragm. Florist. Geobot. 37: 443–475.
CCDB · book-northern-plants — Avdulov 1931, Kattermann (T. 1935J1936).
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov)
CCDB · CromoCat 2015 — Frey, L. (1993). Taxonomy, karyology and distribution of selected genera of tribe Aveneae (Poaceae) in Poland: III. Koeleria Fragmenta Floristica et Geobotanica Suppl. 2(1): 251-278
CCDB · CromoCat 2015 — Morrison, M. E. S. (1959). Interrelationships of some species of trisetum from North America and Europe Canad. J. Genet. Cytol. 1: 84-88
CCDB · CromoCat 2015 — Skalinska, M., E. Pogan, R. Czapik. (1978). Further studies in chromosome numbers of Polish Angiosperms. XII. Acta Biol. Cracov., Ser. Bot. 21: 31-63.
CCDB · CromoCat 2015 — Frey, L. (1992). Taxonomy, karyology and distribution of the selected genera of tribe Aveneae (Poaceae) in Poland: II. Trisetum Fragmenta Floristica et Geobotanica 37: 443-475
2n 126×CCDB · ita-fl · CCDB · iapt · CCDB · ipcn-api-dl
CCDB · ita-fl — SIGNORINI M. A., MORI B. - 1996. Indagini citotassonomiche su entit endemiche mediterranee di Trisetum Gr. Flavescens.. Giorn. Bot. Ital. , 130(1): 372.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · ipcn-api-dl — KERGUELEN, M. 1975. Les Gramineae (Poaceae) de la flore Francaise essai de mise au point taxonomique et nomenclaturale. Lejeunia 75: 1–343.
CCDB · ipcn-api-dl — Galland, N. 1985. Chromosome Number Reports LXXXVII. Taxon 34: 346–351.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
2n 366×CCDB · ipcn-api-dl · CCDB · CromoCat 2015 · CCDB · Original-count
CCDB · ipcn-api-dl — Strid, A. 1983. In IOPB chromosome number reports LXXVIII. Taxon 32: 138–140.
CCDB · ipcn-api-dl — Strid, A. & I. A. Andersson. 1985. Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203–228.
CCDB · CromoCat 2015 — Strid, A. & I. A. Andersson. (1985a). Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203-228.
CCDB · CromoCat 2015 — Strid, A. (1983). In IOPB chromosome number reports LXXVIII. Taxon 32: 138-140.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1983a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVIII]. Taxon 32(1): 138-140.
CCDB · Original-count — Winterfeld, G., Röser, M. (2007). Chromosomal localization and evolution of satellite DNAs and heterochromatin in grasses (Poaceae), especially tribe Aveneae. Pl. Syst. Evol. 264: 75–100. doi: 10.1007/s00606-006-0482-26
2n 381×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
2n 401×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
n 61×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
n 191×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
n 211×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type248 677 records
Wild obs. + sensor239 929
Museum / vouchered6 550
Cultivated / captive918
Other1 280
Origin
Native18 780
Introduced17
Range
Area of Occupancy AOO237 620 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy30% within 1 km
≤100 m 20 459≤1 km 33 347≤10 km 127 552>10 km 928
182 286 georeferenced · 57 643 without coordinates
Open the mapobservation + sensor239 929
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 802≤1 km 1 081≤10 km 2 516>10 km 132
4 531 georeferenced · 2 019 without coordinates
Open the institutions mapphysical evidence6 550
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 7
9 georeferenced · 909 without coordinates
Open the mapnot free-living918
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions91 of 165 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 985 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 812 |
| Salzburg, AT | 366 |
| LDlocation not on record | 336 |
| BFLlocation not on record | 306 |
| Uppsala, SE | 183 |
| Moscow State Universitylocation not on record | 164 |
| MeiseBGlocation not on record | 161 |
| SLU Artdatabankenlocation not on record | 119 |
| Tartu, EE | 87 |
| Provincia di Livornolocation not on record | 84 |
| Oskarshamn, SE | 72 |
| Görlitz, DE | 65 |
| BRNUlocation not on record | 62 |
| Barcelona, ES | 56 |
| Adam Mickiewicz University in Poznańlocation not on record | 54 |
| Olocation not on record | 52 |
| BDBClocation not on record | 51 |
| València, ES | 48 |
| MAlocation not on record | 47 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 42 |
| BClocation not on record | 41 |
| Wlocation not on record | 35 |
| South Kensington, GB | 33 |
| Helsinki, FI | 31 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 30 |
| Entomological Society of Latvialocation not on record | 28 |
| Dresden, DE | 28 |
| GZUlocation not on record | 26 |
| Bern, CH | 24 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 23 |
| Karlsruhe, DE | 22 |
| GJOlocation not on record | 21 |
| Zürich, CH | 21 |
| Bergen, NO | 21 |
| Salamanca, ES | 19 |
| Turku, FI | 17 |
| IFR-DNFlocation not on record | 16 |
| Tallinn, EE | 15 |
| Berlin, DE | 15 |
| Trondheim, NO | 15 |
| UniKSlocation not on record | 13 |
| Zürich, CH | 13 |
| Mlocation not on record | 13 |
| Pamplona, ES | 13 |
| Beijing, CN | 12 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 12 |
| TUR-Alocation not on record | 12 |
| Frankfurt am Main | 12 |
| Glarus, CH | 12 |
| DBF-NHMDlocation not on record | 12 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| CZE082location not on record | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Uniwersytet Jagiellońskilocation not on record | 10 |
| Oulu, FI | 9 |
| Mount Annan, AU | 8 |
| Tilburg, NL | 8 |
| University of Stellenboschlocation not on record | 7 |
| Porrentruy, CH | 7 |
| BSBIlocation not on record | 7 |
| Uniwersytet Warszawskilocation not on record | 7 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 7 |
| Pamplona, ES | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| KMNlocation not on record | 6 |
| SVN019location not on record | 6 |
| Museo Achille Folettolocation not on record | 6 |
| Madrid, ES | 5 |
| Nijmegen, NL | 5 |
| PRClocation not on record | 5 |
| CJBGlocation not on record | 5 |
| Vitoria, ES | 5 |
| Auckland, NZ | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Sevilla, ES | 4 |
| SZUlocation not on record | 4 |
| Wellington, NZ | 4 |
| CICYTEXlocation not on record | 4 |
| Logan, US | 4 |
| Philadelphia, US | 4 |
| Bourges, FR | 4 |
| Burlington, US | 4 |
| Fulda, DE | 4 |
| Frauenfeld, CH | 4 |
| Kew, GB | 4 |
| Museo Entomologico de Leonlocation not on record | 4 |
| National Museum Waleslocation not on record | 3 |
| Taipei, TW | 3 |
| Paris, FR | 3 |
| TROMlocation not on record | 3 |
| Canberra, AU | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Guangzhou, CN | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Xiamen, CN | 3 |
| Sant Julià de Lòria, AD | 2 |
| Edinburgh, GB | 2 |
| Boise, US | 2 |
| Coimbra, PT | 2 |
| HUN003location not on record | 2 |
| Christchurch, NZ | 2 |
| Namur, BE | 2 |
| POL003location not on record | 2 |
| Pullman, US | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Porvoo, FI | 2 |
| Lausanne, CH | 2 |
| San Angelo, US | 2 |
| Kensington, AU | 2 |
| Kuopio, FI | 2 |
| Brisbane, AU | 2 |
| Armidale, AU | 2 |
| Brussel, BE | 2 |
| FLADlocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Winterthur, CH | 1 |
| EL PASO, US | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Boumlocation not on record | 1 |
| LUXEMBOURG, LU | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| Alicante, ES | 1 |
| Banyoles, ES | 1 |
| Gijón, ES | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Jaén, ES | 1 |
| Victoria, CA | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Denver, US | 1 |
| Acadia Universitylocation not on record | 1 |
| Claremont, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Québec, CA | 1 |
| San Isidro, AR | 1 |
| Columbia, US | 1 |
| Knoxville, US | 1 |
| H-AkrKGlocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| ESP119location not on record | 1 |
| Tampa, US | 1 |
| Saint Louis, US | 1 |
| Montréal, CA | 1 |
| Jackson, US | 1 |
| LfUlocation not on record | 1 |
| Forssa, FI | 1 |
| Oswego, US | 1 |
| Bronx, US | 1 |
| Chongqing Museumlocation not on record | 1 |
| Monastir, TN | 1 |
| Macomb, US | 1 |
| Vancouver, CA | 1 |
| Stockholm, SE | 1 |
| Bloomington, US | 1 |
| New Haven, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Flagstaff, US | 1 |
| nbflocation not on record | 1 |
165 institutions · 6 094 of 6 550 vouchered records shown · 423 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Trisetum flavescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map5 countries0
on sandy soil
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.8 °C 12.9–18.1
Seasonal swing summer↔winter14.9 °C
Max temp (day)19.7 °C 15.0–23.6
Min temp (night)11.6 °C 10.0–13.5
Precipitation80.5 mm/mo 71.5–124
Air humidity61.1 % 57.0–67.7
Moisture balance-37.1 mm/mo -69.5–39.1
Vapour deficit717 Pa 511–893
Wind speed3.90 m/s 3.00–6.00
Cloud cover41.2 % 35.8–51.7
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.