Tripterocalyx micranthus

(Torr.) Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Nyctaginaceae/Tripterocalyx

At a glance

Occurrence records397

Data sources8

Biological traits10

DNA specimens6

eDNA detections4

Sources8 archives

Databases and archives Tripterocalyx micranthus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility397 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF397 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Tripterocalyx micranthus is a species of flowering plant in the four o'clock family known by the common names smallflower sandverbena and small-flowered sand-verbena. It is native to North America, where it is known from southern Alberta and Saskatchewan through a section of the central United States toward the desert southwest in California, Arizona, and New Mexico. It can be found in several types of habitat, including sandy and scrubby desert regions and sagebrush.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tripterocalyx micranthus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences6

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG236777.1 ↗334 bpCanada · 1977

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCACTAGGCTGAAGGCACGTCTGCCTGGGCGTCACACACA …

Tripterocalyx micranthus voucher CCDB-24803-B11 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type397 records

Wild obs. + sensor155

Museum / vouchered242

Range

Area of Occupancy AOO1 140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 79≤1 km 8≤10 km 8>10 km 13

108 georeferenced · 47 without coordinates

Open the mapobservation + sensor155

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 9≤1 km 40≤10 km 60>10 km 13

122 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence242

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	41
Bronx, US	33
Albuquerque, US	26
Musee des Dinosaures d'Esperaza (Aude)location not on record	19
Wuzhou, CN	14
Logan, US	14
Lubbock, US	10
Provo, US	8
Denver, US	7
Claremont, US	7
ASUlocation not on record	6
Flagstaff, US	5
Spearfish, US	5
Missoula, US	4
DOI/NPS, Greenbelt Parklocation not on record	4
Orem, US	4
Chadron, US	4
Chongqing Museumlocation not on record	3
Durango, US	3
Moscow, US	3
Riverside, US	2
Brookings, US	2
San Angelo, US	2
Tempe, US	2
Phoenix, US	1
Henderson, US	1
Chapel Hill, US	1
San Luis Obispo, US	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
Philadelphia, US	1
Bandelier National Monumentlocation not on record	1
Burlington, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Bloomington, US	1

35 institutions · 239 of 242 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Tripterocalyx micranthus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

dry established talus fans at foot of cliffssand dune, sandy area

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)