Tripora divaricata

(Maxim.) P.D.Cantino · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Tripora

At a glance

Occurrence records205

Data sources11

Biological traits10

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Tripora divaricata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility205 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS28 compounds

Occurrence & distributionGBIF205 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Tripora is genus of plants in the family Lamiaceae, first described as a genus in 1999. It includes only one known species, Tripora divaricata, native to Japan, Korea, and China (Gansu, Henan, Hubei, Jiangxi, Shaanxi, Shanxi, Sichuan).Kew World Checklist of Selected Plant FamiliesFlora of China Vol. 17 Page 46 莸 you Caryopteris divaricata Maximowicz, Bull. Acad. Imp. Sci. Saint-Pétersbourg. 23: 390. 1877 It is still referred to by its synonym Caryopteris divaricata in the literature.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.8 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formperennial or subshrub

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Herbaceous

Woodinessnon-woody

03Chemical composition28 compounds

Compounds documented for Tripora divaricata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones11

Colensane and Clerodane diterpenoids8

Neolignans6

Carotenoids (C40, β-Ψ)1

Cinnamic acids and derivatives1

Documented compounds28 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3S,4S,5R,6R)-3,4,5-trihydroxy-6-[5-hydroxy-2-(4-methoxyphenyl)-4-oxochromen-7-yl]oxyoxane-2-carboxylic acid	present	LOTUS
(2S,3S,4S,5R,6R)-6-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-3,4,5-trihydroxyoxane-2-carboxylic acid	present	LOTUS
(2S,3S,4S,5R,6S)-6-[5,6-dihydroxy-2-(4-methoxyphenyl)-4-oxochromen-7-yl]oxy-3,4,5-trihydroxyoxane-2-carboxylic acid	present	LOTUS
(4R)-4-[(2R)-1-(3,4-dimethoxyphenyl)propan-2-yl]-4,5-dimethoxy-2-prop-2-enylcyclohexa-2,5-dien-1-one	present	NPASS
(4R)-4-[(2R)-1-(4-hydroxy-3-methoxyphenyl)propan-2-yl]-4,5-dimethoxy-2-prop-2-enylcyclohexa-2,5-dien-1-one	present	NPASS
(4R,6S)-4-(4,5-dimethoxy-2-prop-2-enylphenoxy)-3,4-dimethoxy-6-prop-2-enylcyclohex-2-en-1-one	present	NPASS
(4S)-4-[(2R)-1-(4-hydroxy-3-methoxyphenyl)propan-2-yl]-4,5-dimethoxy-2-prop-2-enylcyclohexa-2,5-dien-1-one	present	NPASS
1'-beta-Glucopyranosyl-3,4,3',4'-tetradehydro-1', 2'-dihydro-beta,psi-caroten-2-one	present	NPASS
2-Allyl-4,5-Dimethoxyphenol	present	NPASS
3-Deacetoxycaryoptin hydrate	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tripora divaricata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences5

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF477773.1 ↗591 bp

ACGT

CCGAAACCTGCAAAGCAGCCCGCGAACACGTGTTTAACCACAACGGGGCGGCGCGCCCGGGGCGTGCCCCAGGCCGCCGTCCCGACCCCC …

Caryopteris divaricata internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tripora divaricata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 25

08Occurrence & distribution

Record type205 records

Wild obs. + sensor89

Museum / vouchered116

Range

Area of Occupancy AOO500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 13≤1 km 7≤10 km 4>10 km 2

26 georeferenced · 63 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤1 km 10≤10 km 9

19 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	24
KIRMlocation not on record	12
Herbarium of the Department of Botany, University of Tokyolocation not on record	12
National Institute of Biological Resourceslocation not on record	8
Korea National Arboretumlocation not on record	7
Kochi, JP	7
Kyoto Universitylocation not on record	6
Fukushima Universitylocation not on record	4
Iwate Prefectural Museumlocation not on record	4
Hokkaido University Museumlocation not on record	4
Sendai, JP	4
Bando, JP	4
Bronx, US	3
Otaru, JP	3
Elocation not on record	3
JP	2
DMZ botanic gardenlocation not on record	2
Toyama, JP	2
South Kensington, GB	2
Beijing, CN	1
Kew, GB	1
Tomioka, JP	1

22 institutions · 116 of 116 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Tripora divaricata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)