Tripodion tetraphyllum

(L.) Fourr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Tripodion

At a glance

Occurrence records5 696

Data sources10

Biological traits17

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Tripodion tetraphyllum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 696 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF5 696 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Tripodion tetraphyllum is a species of annual herb in the family Fabaceae. They have a self-supporting growth form and compound, broad leaves. Individuals can grow to 0.2 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.048 m

Seed mass7.9 mg

⚠ sources differ — TRY: 7.9 mg · GIFT: 10.42 mg

Seed mass max12.89 mg

Seed mass min2.5 mg

Life cycle & reproduction4

Life formannual

Life spanannual

Lifespan years2.5 years

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza type0.0000000147

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tripodion tetraphyllum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences7

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAJ512923.1 ↗214 bpPortugal

ACGT

CATCGTTGCCCCAACGCTAAACGCTTCGTGCTATACGGCGTGCGGGGTGAATGTTGGCCTCCCGTGAGTGTACTCTCACGGTTGGTTGAA …

Anthyllis tetraphylla internal transcribed spacer 2 (ITS2), from Portugal

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tripodion tetraphyllum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidypolyploid inferred

Chromosome records16–162n range16median16mode18records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1618×CCDB · iapt · CCDB · iber-fl · CCDB · mediterranean +5

CCDB · iapt — IAPT/IOPB Chromosome Data 8

CCDB · iber-fl — Aportaciones al conocimiento cariolgico de la tribu Loteae (Fabaceae). Vioque, J. & J. Pastor.Lazaroa12: 9-19(1991).

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 252: 79-164(1978).

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).

CCDB · iber-fl — IOPB. Chromosome number reports. LIV. Fernndez Piqueras, J.Taxon25(5/6): 641-642(1976).

CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).

CCDB · mediterranean

CCDB · ipcn-api-dl — Frizzi, G. 1984. Numeri cromosomici per la flora Italiana: 1003--1006. Inform. Bot. Ital. 16: 243–245.

CCDB · ipcn-api-dl — Vioque, J. & J. Pastor. 1991. Aportaciones al conocimiento cariológico de la tribu Loteae (Fabaceae). Lazaroa 12: 9–19.

CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.

CCDB · ipcn-api-dl — FERNANDEZ PIQUERAS, J. 1976. In IOPB chromosome number reports LIV. Taxon 25: 631–649.

CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.

CCDB · book-ipcn72 — KRAMER, K.U., L.Y TH.WESTRA, E. KLIPHUIS, & T.W.J. GADELLA. 1972. Floristic and cytotaxonomic notes on the flora of the Maltese islands. Acta Bot. Neerl. 21: 54-66 .

CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.

CCDB · book-ipcn75-78 — Fernandez Piqueras 1976

CCDB · book-ipcn75-78 — Fernandes & Queiros 1978

CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.

CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.

n 84×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1

CCDB · iber-fl — IOPB. Chromosome number reports. LIV. Fernndez Piqueras, J.Taxon25(5/6): 641-642(1976).

CCDB · ipcn-api-dl — FERNANDEZ PIQUERAS, J. 1976. In IOPB chromosome number reports LIV. Taxon 25: 631–649.

CCDB · book-ipcn75-78 — Fernandez Piqueras 1976

CCDB · Cannon, 2015 — Fernandez Casas, J. & J. Fernandez Piqueras., 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.984 ↗

08Occurrence & distribution

Record type5 696 records

Wild obs. + sensor5 060

Museum / vouchered620

Other16

Origin

Native43

Range

Area of Occupancy AOO12 648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 1 713≤1 km 511≤10 km 1 204>10 km 47

3 475 georeferenced · 1 585 without coordinates

Open the mapobservation + sensor5 060

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 18≤1 km 88≤10 km 63

169 georeferenced · 451 without coordinates

Open the institutions mapphysical evidence620

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	118
LDlocation not on record	112
Berlin, DE	68
MAlocation not on record	57
BClocation not on record	50
CJBGlocation not on record	32
CICYTEXlocation not on record	22
College of the Atlantic, Museumlocation not on record	18
Badajoz, ES	16
Alicante, ES	16
Wlocation not on record	15
UIBlocation not on record	9
Sevilla, ES	7
Moscow State Universitylocation not on record	7
Museo della Bonifica di San Donà di Piavelocation not on record	6
Paris, FR	6
Phyletisches Museum Jenalocation not on record	5
Karlsruhe, DE	4
València, ES	4
GZUlocation not on record	3
Jaén, ES	3
Granada, ES	3
Madrid, ES	2
Muséum Henri Lecoqlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Provincia di Livornolocation not on record	2
Stockholm, SE	2
GJOlocation not on record	2
Frankfurt am Main	2
BRNUlocation not on record	2
Dresden, DE	2
Natural History Museum Rotterdamlocation not on record	2
Kew, GB	1
Coimbra, PT	1
University of Stellenboschlocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Museo Achille Folettolocation not on record	1
Entomological Society of Latvialocation not on record	1
Córdoba, ES	1
Bourges, FR	1
Rishon Le Zion, IL	1
Pamplona, ES	1

42 institutions · 611 of 620 vouchered records shown · 9 without an institution code

09Environmental DNA2 detections

Where the DNA of Tripodion tetraphyllum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tripodion tetraphyllum

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 696 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type5 696 records