Triplophysa stolickai

(Steindachner, 1866) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Nemacheilidae/Triplophysa

At a glance

Occurrence records32

Data sources6

Biological traits5

DNA specimens238

eDNA detections0

Sources6 archives

Databases and archives Triplophysa stolickai's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility32 records↗

BOLD SystemsCentre for Biodiversity Genomics238 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF32 records

DNA & barcodingBOLD238 specimens

01Narrative

The Tibetan stone loach (Triplophysa stolickai) is a species of ray-finned fish in the family Nemacheilidae. The specific name is sometimes spelled stoliczkae but the original spelling used by Steindachner is stoličkai.Wu, Y.-Y., Sun, Z.-Y. & Guo, Y.-S. (2016): A new species of the genus Triplophysa (Cypriniformes: Nemacheilidae), Triplophysa daochengensis, from Sichuan Province, China. Zoological Research, 37 (5): 290-296. It is found in southern and central Asia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length16.2 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding238 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Triplophysa stolickai has left across the world's sequence archives.

At a glance

DNA specimens238

BINs2

Marker genes11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P576 bp consensus228 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

78Amostly conserved

93Tmostly conserved

165Gmostly conserved

168Amostly conserved

174Gmostly conserved

180Cmostly conserved

189Amostly conserved

198Cmostly conserved

201Amostly conserved

207Tmostly conserved

210Amostly conserved

225Gmostly conserved

228Gmostly conserved

234Tmostly conserved

244Cmostly conserved

255Amostly conserved

267Gmostly conserved

279Cmostly conserved

294Cmostly conserved

297Cmostly conserved

300Cmostly conserved

312Cmostly conserved

327Amostly conserved

339Gmostly conserved

360Tmostly conserved

363Tmostly conserved

384Cmostly conserved

390Gmostly conserved

393Cmostly conserved

396Cmostly conserved

415Gmostly conserved

420Cmostly conserved

426Gmostly conserved

441Cmostly conserved

456Amostly conserved

462Tmostly conserved

468Gmostly conserved

474Gmostly conserved

475Tmostly conserved

495Cmostly conserved

513Cmostly conserved

516Avariable

528Tmostly conserved

534Amostly conserved

540Amostly conserved

567Tmostly conserved

568Cmostly conserved

571Tmostly conserved

572Gmostly conserved

573Amostly conserved

576Cmostly conserved

ACTGCCCTAAGCCTATTAATTCGAGCTGAACTAAGCCAGCCGGGGTCCCTCCTCGGCGATGATCAAATCTACAACGTAATTGTTACCGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes31

BINs2

Most divergent pair9.2%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Triplophysa orientalissame genus5.7%Triplophysa tenuissame genus5.9%Triplophysa ferganaensissame genus6.2%Triplophysa brevicaudasame genus6.2%Triplophysa scleropterasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_017890 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type32 records

Wild obs. + sensor9

Museum / vouchered23

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	12

1 institutions · 12 of 23 vouchered records shown · 11 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)