Triplochiton scleroxylon

K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Triplochiton

At a glance

Occurrence records4 419

Data sources11

Biological traits25

DNA specimens14

eDNA detections8

Sources11 archives

Databases and archives Triplochiton scleroxylon's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 419 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF4 419 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceGoaTgenome

01Narrative

Triplochiton scleroxylon is a tree of the genus Triplochiton of the family Malvaceae. The timber is known by the common names African whitewood, abachi, obeche (in Nigeria), wawa (in Ghana), ayous (in Cameroon) and sambawawa (in Ivory Coast). The tree is the official state tree of Ekiti State, Nigeria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf size123 mm²

Plant height37.5 m

⚠ sources differ — GIFT: 37.5 m · TRY: 40 m

Plant height max60.96 m

Seed mass301 mg

Seed mass max310 mg

Seed mass min292 mg

Life cycle & reproduction5

Deciduousnessdeciduous

Dispersal typewind

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Top.Canopy.Tree

Woodinesswoody

Physiology & chemistry7

Leaf c450 mg/g

Leaf dry-matter content (LDMC)627 mg/g

Leaf n32.11 mg/g

Leaf p1.76 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density335 mg/cm³

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Triplochiton scleroxylon has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes3

GenBank sequences2

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMN366844.1 ↗528 bp

ACGT

GTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATCAAGTCAAAGATACTGATATCTTGGCAGCCTTCCGAGTAACTCCTCAACCC …

Triplochiton scleroxylon voucher IDRCG078-13_BRLU_NB0590 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

06Genome at a glanceGoaT

The complete instruction manual Triplochiton scleroxylon carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 419 records

Wild obs. + sensor3 728

Museum / vouchered373

Other318

Range

Area of Occupancy AOO2 992 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 103≤1 km 16

119 georeferenced · 3 609 without coordinates

Open the mapobservation + sensor3 728

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 372 without coordinates

Open the institutions mapphysical evidence373

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LaCarto/IGATE/UAClocation not on record	157
Paris, FR	36
LSF/FSA/UAClocation not on record	23
IBANNlocation not on record	19
MeiseBGlocation not on record	15
Yaoundé, CM	10
Saint Louis, US	9
Kew, GB	8
Universite Libre de Bruxelles, Herbariumlocation not on record	7
BRLUlocation not on record	6
HNBlocation not on record	5
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	5
CNF-UFHBlocation not on record	4
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	3
Bronx, US	2
LSFlocation not on record	2
Leiden University Medical Centerlocation not on record	2
Institut Botanique Ake-Assi d'Andokoilocation not on record	2
Université du Lomélocation not on record	2
Plocation not on record	1
CMULlocation not on record	1
Salvador, BR	1
Frankfurt am Main	1
University of Stellenboschlocation not on record	1
Edinburgh, GB	1

25 institutions · 323 of 373 vouchered records shown · 50 without an institution code

09Environmental DNA8 detections

Where the DNA of Triplochiton scleroxylon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.5 °C 26.2–26.8

Seasonal swing summer↔winter3.40 °C

Max temp (day)30.7 °C 30.1–31.8

Min temp (night)23.1 °C 22.6–23.6

Precipitation162 mm/mo 61.5–177

Air humidity66.3 % 62.1–67.6

Moisture balance7.60 mm/mo -81.2–20.9

Vapour deficit1,161 Pa 1,112–1,335

Wind speed2.10 m/s 1.60–2.70

Cloud cover34.9 % 15.2–37.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Triplochiton scleroxylon

At a glance

Sources11 archives

Size & morphology6

Life cycle & reproduction5

Diet & foraging1

Habitat & environment6

Physiology & chemistry7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 419 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 419 records