Tripleurospermum tenuifolium

(Kit. ex Schult.) Freyn ex Freyn & E.Brandis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Tripleurospermum

At a glance

Occurrence records88

Data sources8

Biological traits10

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Tripleurospermum tenuifolium's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF88 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Tripleurospermum tenuifolium is a species of daisy in the family Asteraceae and is in the tribe Anthemideae. It ranges from Austria, Hungary, through southeastern Europe to Turkey, and the Caucasus. Its chromosome count is 2n=28.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max1 m

Plant height min0.5 m

Life cycle & reproduction4

Flowering endOct

Flowering startJul

Life spanbiennial/perennial

⚠ sources differ — TRY: biennial/perennial · GIFT: variable

Raunkiær life formhemicryptophyte

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formherb

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Tripleurospermum tenuifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Unsaturated fatty acids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
2(E),8(E)-Matricaria ester		present	LOTUS
2,8-Decadiene-4,6-diynoic acid, methyl ester		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tripleurospermum tenuifolium has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMG740705.1 ↗639 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACACGTAAAAACAACTGAGCGTCGAGAGTGGACCAAGGAATTTTTGAATACACTCGATGC …

Tripleurospermum tenuifolium voucher Inceer 722 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tripleurospermum tenuifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Jasiewicz, A. & M. Mizianty. 1975. Chromosome numbers of some Bulgarian plants. Fragm. Florist. Geobot. 21: 277–288.

CCDB · ipcn-api-dl — Strid, A. 1980. In Chromosome number reports LXIX. Taxon 29: 709–710.

CCDB · ipcn-api-dl — Kuzmanova, B., S. Georgieva & V. Nikolova. 1979a. In IOPB chromosome number reports LXIV. Taxon 28:408.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type88 records

Wild obs. + sensor43

Museum / vouchered45

Origin

Introduced41

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤1 km 41>10 km 2

43 georeferenced

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 3≤1 km 2≤10 km 2

7 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	26
Wlocation not on record	6
LDlocation not on record	6
Görlitz, DE	2
GJOlocation not on record	2
Moscow State Universitylocation not on record	1
GZUlocation not on record	1
Edinburgh, GB	1

8 institutions · 45 of 45 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)