Tripleurospermum inodorum
(L.) Sch.-Bip · speciesAt a glance
Occurrence records291 759
Data sources14
Biological traits61
DNA specimens21
eDNA detections10
Sources14 archives
Databases and archives Tripleurospermum inodorum's data was compiled from.
WikipediaWikimedia Foundation8 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility291 759 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics21 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources61 traits
Chemical compositionLOTUS · NPASS31 compounds
Occurrence & distributionGBIF291 759 records
Environmental DNA1 datasets · 3 countries10 detections
DNA & barcodingBOLD · NCBI21 specimens
Genome at a glanceCCDB · GoaT4.9 Gbp
01Narrative
Tripleurospermum inodorum, common names scentless false mayweed, scentless mayweed, scentless chamomile, wild chamomile, mayweed, false chamomile, and Baldr's brow, is the type species of Tripleurospermum. This plant is native to Eurasia and North Africa, and introduced to North America, where it is commonly found in fields, fallow land and gardens. Historically included the genus Matricaria, Tripleurospermum inodorum has been the subject of some controversy, with many revisions in recent years. The Flora Europaea uses Matricaria perforata for this species. Synonyms/other scientific names include Tripleurospermum perforatum (Mérat) Lainz, Tripleurospermum maritimum subsp. inodorum.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVP
Size & morphology20
Fruit length2 mm
Fruit length max2.3 mm
Fruit length min1.4 mm
Leaf length max150 mm
Leaf length min15 mm
Leaf mass12.82 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 175 mm² · GIFT: 251 mm²
Leaf width35 mm
Leaf width max60 mm
Leaf width min10 mm
Plant height0.57 m
⚠ sources differ — GIFT: 0.57 m · TRY: 0.634 m
Plant height generative0.576 m
Plant height max0.8 m
Plant height min0.225 m
Seed length2 mm
Seed length max2 mm
Seed length min2 mm
Seed mass0.149 mg
⚠ sources differ — TRY: 0.149 mg · LEDA: 0.29 mg · GIFT: 0.275 mg
Seed mass max0.49 mg
Seed mass min0 mg
Life cycle & reproduction16
Deciduousnesssemi-evergreen
⚠ sources differ — TRY: semi-evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colourwhite
Flower width max30 mm
Flower width min15 mm
Flowering endSep
Flowering startJun
Life formannual or biennial
Life spanannual
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number105 000
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 550 m
Elevation mean1 100 m
Elevation min150 m
Epiphyteterrestrial
Fruit colourbrown
Fruit typeachene
Growth formherb
Habitat GIFTcrop fields, irrigation channals, meadows, mountains, rivers, roadsides, saline places
Leaf formlinear
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf c418 mg/g
Leaf dry-matter content (LDMC)207 mg/g
⚠ sources differ — TRY: 207 mg/g · LEDA: 133 mg/g
Leaf n16.5 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)17.59 mm²/mg
⚠ sources differ — TRY: 17.59 mm²/mg · LEDA: 21.4 mm²/mg · GIFT: 22.18 mm²/mg
Other traits3
Diaspore typegenerative dispersule
Leaf arrangementalternate
Shoot orientationerect
03Chemical composition31 compounds
Compounds documented for Tripleurospermum inodorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Unsaturated fatty acids5
Oxygenated hydrocarbons2
Germacrane sesquiterpenoids2
Branched fatty acids $ Unsaturated fatty acids2
Hydrocarbons2
Documented compounds31 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Maackiain | present | NPASS | |
| (-)-Caryophyllene | present | LOTUS | |
| (1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol | present | LOTUS | |
| (2Z,8Z)-Matricaria Acid Methyl Ester | present | LOTUS | |
| (5E)-5-[(Z)-hex-4-en-2-ynylidene]furan-2-one | present | LOTUS | |
| (E,Z)-Marticaria ester | present | LOTUS | |
| (S,1Z,6Z)-8-Isopropyl-1-methyl-5-methylenecyclodeca-1,6-diene | present | LOTUS | |
| 2(5H)-Furanone, 5-(4-hexen-2-ynylidene)- | present | LOTUS | |
| 2(E),8(E)-Matricaria ester | present | LOTUS | |
| 2,8-Decadiene-4,6-diynoic acid, methyl ester | present | LOTUS |
05DNA & barcoding21 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tripleurospermum inodorum has left across the world's sequence archives.
At a glance
DNA specimens21
Marker genes7
GenBank sequences10
eDNA detections10
Countries4
The DNA barcodea real sequence read deposited for this species
GCATTTACCTTTGTTCTTTTGGACTTGGTGAATGTGTCATTGGCGCAATAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTT …
Tripleurospermum inodorum voucher KS23 HER0390 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK4★rbcL2★rbcLa★ITS4★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Tripleurospermum inodorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 890 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Tripleurospermum inodorum4.89 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidypolyploid inferred
Chromosome records18–362n range36median36mode51records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3633×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · iapt
CCDB · brit-fl — Kay, Q.O.N. Watsonia 7: 130-141 (1969)
CCDB · fl-europaea — Fritsch, 1973
CCDB · book-ipcn65 — Koul 1963-64a
CCDB · ipcn-api-dl — Arora, O. P. & K. J. Madhusoodana. 1981. Nature of tetraploidy in Matricaria inodora L. Cytologia 46: 773–779.
CCDB · ipcn-api-dl — Kuzmanova, B. & S. Georgieva. 1980. In Chromosome number reports LXIX. Taxon 29: 715.
CCDB · ipcn-api-dl — Samatadze, T. E. 1998. Comparative cytogenetic study of three species of the genus Matricaria L. Thesis Diss. Cand Biol. Sci. Moscow.
CCDB · ipcn-api-dl — Samatadze, T. E., O. V. Muravenko & A. V. Zelenin. 1998. Comparison of C-banded chromosomes in karyotypes of three species of the genus Matricaria L. Genetika 34(12): 1720–1724.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žhurn. (Moscow & Leningrad) 79(2): 135–139.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — UOTILA, P. & K. Pellinen. 1985. Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Frey, L., M. Mizianty & Z. Mirek. 1981. Chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 581–590.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn73-74 — FRITSCH, R.M. 1973. In IOPB chromosome number reports XLI. Taxon 459-464.
CCDB · book-indian_vol1 — Koul, M.L.H. 1964b ; Gadella, T.W.J. & Kliphuis, :E. 1966
CCDB · book-fedorov — Koul M. L. 1964b
CCDB · book-fedorov — Gadella, Kliphuis 1966
CCDB · iapt — IAPT/IOPB Chromosome Data 23
CCDB · iapt — IAPT/IOPB Chromosome Data 27
CCDB · iapt — IAPT/IOPB Chromosome Data 30
CCDB · iapt — IAPT/IOPB Chromosome Data 32
2n 1818×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · iapt · CCDB · brit-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — Kay, Q.O.N. Watsonia 7: 130-141 (1969)
CCDB · brit-fl — Kay, Q.O.N. Watsonia 9: 81-107 (1972)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4069
CCDB · fl-europaea — Rottgardt, 1956
CCDB · book-ipcn65 — Kay in V. 1965
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · book-ipcn67-71 — LEVEQUE, M., & R. GORENFLOT. 1969. Prospections caryologiques dans la flore littorale du Boulonnais. Bull. soc. Bot. Nord France 22: 27-58.
CCDB · book-indian_vol1 — Tischler, G. 1934, 1937; Delay, C. 1947 Vaarama (Love, A. & Love, D. 1948) Sor.sa, V. 1962
CCDB · book-fedorov — Tischler 1934, 1937
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Vaarama (LOve A., LOve D. 1948)
CCDB · book-fedorov — Sorsa V. 1962
CCDB · iapt — IAPT/IOPB Chromosome Data 30
n 182×CCDB · book-ipcn65 · CCDB · Cave1963
CCDB · book-ipcn65 — Koul 1963-64a
CCDB · Cave1963 — Sorsa 1962
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type291 759 records
Wild obs. + sensor279 416
Museum / vouchered11 103
Cultivated / captive67
Other1 173
Origin
Native2 262
Introduced7 864
Range
Area of Occupancy AOO423 280 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 74 004≤1 km 66 124≤10 km 110 324>10 km 1 148
251 600 georeferenced · 27 816 without coordinates
Open the mapobservation + sensor279 416
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 718≤1 km 3 653≤10 km 4 509>10 km 329
9 209 georeferenced · 1 894 without coordinates
Open the institutions mapphysical evidence11 103
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 4
4 georeferenced · 63 without coordinates
Open the mapnot free-living67
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions96 of 168 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 6 547 |
| Moscow State Universitylocation not on record | 446 |
| LDlocation not on record | 428 |
| Olocation not on record | 280 |
| Oskarshamn, SE | 168 |
| SLU Artdatabankenlocation not on record | 152 |
| Oulu, FI | 151 |
| Salzburg, AT | 150 |
| Turku, FI | 137 |
| BIO-UNIPIlocation not on record | 115 |
| Jyväskylä, FI | 98 |
| DBF-NHMDlocation not on record | 91 |
| Bergen, NO | 87 |
| Görlitz, DE | 81 |
| South Kensington, GB | 79 |
| Trondheim, NO | 77 |
| Kuopio, FI | 69 |
| BFLlocation not on record | 62 |
| Adam Mickiewicz University in Poznańlocation not on record | 62 |
| BRNUlocation not on record | 60 |
| Montréal, CA | 59 |
| KMNlocation not on record | 57 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 56 |
| Bern, CH | 54 |
| Provincia di Livornolocation not on record | 52 |
| Provo, US | 40 |
| Helsinki, FI | 38 |
| Pullman, US | 37 |
| St. Paul, US | 35 |
| Tula State Universitylocation not on record | 31 |
| WTUlocation not on record | 30 |
| University of Alberta Museumslocation not on record | 28 |
| Christchurch, NZ | 27 |
| GJOlocation not on record | 26 |
| TROMlocation not on record | 25 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 25 |
| Zürich, CH | 24 |
| Denver, US | 24 |
| Berlin, DE | 22 |
| Tartu, EE | 21 |
| Porvoo, FI | 21 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 19 |
| Corvallis, US | 16 |
| Stockholm, SE | 16 |
| Zürich, CH | 15 |
| Auckland, NZ | 15 |
| Wlocation not on record | 15 |
| Logan, US | 13 |
| Madison, US | 13 |
| TUR-Alocation not on record | 12 |
| Karlsruhe, DE | 12 |
| Wellington, NZ | 12 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 12 |
| Tallinn, EE | 11 |
| IWEP FEB RASlocation not on record | 10 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 10 |
| Frauenfeld, CH | 9 |
| Rovaniemi, FI | 9 |
| Urumqi, CN | 8 |
| València, ES | 7 |
| Entomological Society of Latvialocation not on record | 7 |
| Forssa, FI | 6 |
| Whitehorse, CA | 6 |
| Flagstaff, US | 6 |
| Pocatello, US | 6 |
| Boise, US | 6 |
| Vancouver, CA | 6 |
| Dresden, DE | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Dekalb, US | 6 |
| MAlocation not on record | 6 |
| Burlington, US | 5 |
| BG-NMNHSlocation not on record | 5 |
| Anchorage, US | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Porrentruy, CH | 5 |
| University of New Hampshirelocation not on record | 5 |
| PRClocation not on record | 5 |
| Ann Arbor, US | 5 |
| Yangling, CN | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| Uniwersytet Opolskilocation not on record | 4 |
| GZUlocation not on record | 4 |
| Uppsala, SE | 4 |
| Chongqing Museumlocation not on record | 4 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 4 |
| Toronto, CA | 4 |
| BSBIlocation not on record | 3 |
| Phoenix, US | 3 |
| Université Lavallocation not on record | 3 |
| Québec, CA | 3 |
| MeiseBGlocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Dhaka, BD | 3 |
| nbflocation not on record | 3 |
| San Luis Obispo, US | 3 |
| Frankfurt am Main | 3 |
| Wuzhou, CN | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| Durham, US | 3 |
| Phyletisches Museum Jenalocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Kew, GB | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Minia, EG | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Ciudad Autónoma de Buenos Aires, AR | 2 |
| WINlocation not on record | 2 |
| Bloomington, US | 2 |
| Bourges, FR | 2 |
| 2 | |
| Garðabær, IS | 2 |
| Xiamen, CN | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Moscow, US | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Glarus, CH | 2 |
| FLADlocation not on record | 2 |
| Bando, JP | 2 |
| New Brunswick, US | 2 |
| Emporia, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Salamanca, ES | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Pittsburg, US | 1 |
| Ivano-Frankove, UA | 1 |
| ZRC-SAZUlocation not on record | 1 |
| AUAlocation not on record | 1 |
| Durango, US | 1 |
| Northridge, US | 1 |
| Rotorua, NZ | 1 |
| NMBU:MINAlocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Granada, ES | 1 |
| Göteborg, SE | 1 |
| Sion, CH | 1 |
| McWane Science Centerlocation not on record | 1 |
| Yukon Universitylocation not on record | 1 |
| Green Bay, US | 1 |
| Paris, FR | 1 |
| Albuquerque, US | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| College Park, US | 1 |
| Columbia, US | 1 |
| CJBGlocation not on record | 1 |
| Saint Louis, US | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Pamplona, ES | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Guangzhou, CN | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Millersville, US | 1 |
| Córdoba, AR | 1 |
| Taipei, TW | 1 |
| Philadelphia, US | 1 |
| US | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Boumlocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Beijing, CN | 1 |
| Caldwell, US | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| Davis, US | 1 |
168 institutions · 10 575 of 11 103 vouchered records shown · 340 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Tripleurospermum inodorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map3 countries0
on disturbed ground
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.8 °C 9.60–17.9
Seasonal swing summer↔winter11.5 °C
Max temp (day)18.4 °C 10.8–21.7
Min temp (night)9.70 °C 6.70–14.3
Precipitation91.2 mm/mo 58.1–122
Air humidity62.5 % 58.3–63.5
Moisture balance-32.4 mm/mo -55.7–71.0
Vapour deficit696 Pa 436–812
Wind speed3.70 m/s 2.70–4.50
Cloud cover50.5 % 44.9–56.5
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.