Triphora trianthophoros

(Sw.) Rydb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Triphora

At a glance

Occurrence records678

Data sources8

Biological traits12

DNA specimens10

eDNA detections5

Sources8 archives

Databases and archives Triphora trianthophoros's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility678 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Occurrence & distributionGBIF678 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Triphora trianthophoros, the threebirds or three birds orchid, or nodding pogonia, is a species of terrestrial orchid native to eastern North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Triphora trianthophoros has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG215795.1 ↗360 bpCanada · 1968

ACGT

TGCAGAATCCCGCGAACCATCGAGTACTTGAACGCAAGTTGCGCCCAAGGCCAACATGCCGAGGGCACGTCCGCCTGGGGGTCCAGCTAC …

Triphora trianthophoros voucher CCDB-24918-E01 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL7★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type678 records

Wild obs. + sensor553

Museum / vouchered125

Range

Area of Occupancy AOO2 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 36≤1 km 40≤10 km 5>10 km 458

539 georeferenced · 14 without coordinates

Open the mapobservation + sensor553

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 19≤1 km 7≤10 km 31>10 km 6

63 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	34
Saint Louis, US	29
Philadelphia, US	17
Durango, MX	10
Jena Microbial Resource Collectionlocation not on record	8
La Paz, MX	4
Chongqing Museumlocation not on record	4
Tuxtla Gutiérrez, MX	2
Autlán de Navarro, MX	2
Tampa, US	2
ASUlocation not on record	2
The University of Arizonalocation not on record	2
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	1
Austin, US	1
Guatemala City, GT	1
Springfield, US	1
Chapingo, MX	1
Mexico City, MX	1
Durham, US	1
Ciudad de México, MX	1

20 institutions · 124 of 125 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Triphora trianthophoros was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

in dead leaves near rotting logs in hardwood…mature pine-oak forest (Tulip, W. Pine, Ostr…beech woodland, high shade. Deep beech littermature pine-oak forest (Sugar and Red Maple,…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.8–22.8

Seasonal swing summer↔winter27.5 °C

Max temp (day)25.2 °C

Min temp (night)21.1 °C

Precipitation90.1 mm/mo

Air humidity60.0 %

Moisture balance-63.9 mm/mo

Vapour deficit1,108 Pa

Wind speed3.50 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)