Triodia pungens

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Triodia

At a glance

Occurrence records3 539

Data sources8

Biological traits29

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Triodia pungens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 539 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF3 539 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Triodia pungens là một loài thực vật có hoa trong họ Hòa thảo. Loài này được R.Br. miêu tả khoa học đầu tiên năm 1810.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Leaf length250 mm

Leaf size204 mm²

Leaf width1 mm

Plant height0.9 m

Plant height max2.3 m

Plant height min0 m

Seed mass1.14 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typewind

Flowering timeyyyyyyyyyyyy

Life formperennial

Life spanperennial

Pollination syndromeself+wind

Raunkiær life formhemicryptophyte

Resprouting capacitypartial_resprouting

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid hummock

Leaf compoundnesssimple

Leaf shapesubulate

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Triodia pungens has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV987069.1 ↗651 bpAustralia · 2009

ACGT

AACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGTGAACGTGTCATCCATGCCACCGGGTGACGGGGCTCGCACCCGTC …

Triodia pungens strain M.D. Crisp 10589 allele2 from Australia internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS2

fungal barcode

08Occurrence & distribution

Record type3 539 records

Wild obs. + sensor1 888

Museum / vouchered1 244

Cultivated / captive3

Other404

Origin

Native260

Introduced1

Range

Area of Occupancy AOO9 860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 253≤1 km 12≤10 km 46>10 km 4

1 315 georeferenced · 573 without coordinates

Open the mapobservation + sensor1 888

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 300≤1 km 83≤10 km 586>10 km 159

1 128 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence1 244

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	313
Brisbane, AU	272
Canberra, AU	214
Kensington, AU	160
Mount Annan, AU	92
Museo Entomologico de Leonlocation not on record	71
Adelaide, AU	55
Saint Louis, US	12
Smithfield, AU	12
James Cook Townsvillelocation not on record	6
Claremont, US	5
Kew, GB	5
University of Stellenboschlocation not on record	3
BGPAlocation not on record	3
Pretoria, ZA	2
Görlitz, DE	1
Wellington, NZ	1
Hobart, AU	1
CBGlocation not on record	1
Karlsruhe, DE	1
Department of Land Resources Managementlocation not on record	1
Armidale, AU	1

22 institutions · 1 232 of 1 244 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Triodia pungens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 22.6–28.3

Seasonal swing summer↔winter17.1 °C

Max temp (day)31.5 °C 29.1–33.9

Min temp (night)19.0 °C 15.8–22.2

Precipitation39.8 mm/mo 20.4–59.2

Air humidity44.2 % 43.6–44.9

Moisture balance-126 mm/mo -139–-112

Vapour deficit1,925 Pa 1,684–2,165

Wind speed3.60 m/s 3.40–3.90

Cloud cover23.8 % 19.2–28.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Triodia pungens

At a glance

Sources8 archives

Size & morphology7

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

At a glance

Record type3 539 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 539 records