Triniteurybia aberrans

(A.Nelson) Brouillet, Urbatsch & R.P.Roberts · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Triniteurybia

At a glance

Occurrence records15

Data sources9

Biological traits3

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Triniteurybia aberrans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Triniteurybia aberrans, the Idaho goldenweed, is a species of flowering plant in the tribe Astereae within the family Asteraceae.Brouillet, Luc, Urbatsch, Lowell Edward, Roberts, Roland P. 2004. Sida 21(2): 889-900Tropicos, Triniteurybia Brouillet, Urbatsch & R.P. Roberts It is the only species in the genus Triniteurybia. Triniteurybia aberrans is native to the United States, in the Sawtooth Mountains of Idaho and the Bitterroot Range of Montana.Flora of North America, Vol. 20 Page 383, Idaho goldenweed, Triniteurybia aberrans (A. Nelson) Brouillet, Urbatsch & R. P. Roberts, Sida. 21: 898. 2004.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Habitat & environment2

Climberself-supporting

Growth formSubshrub, Forb/herb

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Triniteurybia aberrans has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAY772426.1 ↗622 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGCGAACATGTTACAACAACCATGCCAGGATGGGTCGGGCATTTGTTCGATCCTCGTGGCACACC …

Triniteurybia aberrans clone 2 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Triniteurybia aberrans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n -11×CCDB · asterace

CCDB · asterace — Anderson 1980a Great Basin Natur. (= Western North American Naturalist)

2n 181×CCDB · eflora

CCDB · eflora

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Anderson, L. C. 1980a. Haplopappus alpinum (Asteraceae): a new species from Nevada. Great Basin Naturalist 40: 73–77.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type15 records

Museum / vouchered15

Range

Area of Occupancy AOO44 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence15

10Collections & institutions

Holding institutions9 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	4
Boise, US	3
US	2
Wuzhou, CN	1
Moscow, US	1
Bozeman, US	1
Pullman, US	1
Missoula, US	1
Montréal, CA	1

9 institutions · 15 of 15 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Triniteurybia aberrans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)