Trillium vaseyi

Harb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Melanthiaceae/Trillium

At a glance

Occurrence records1 022

Data sources11

Biological traits10

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Trillium vaseyi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 022 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF1 022 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 10

01Narrative

Trillium vaseyi, the sweet wakerobin or sweet beth, is a spring flowering perennial plant which is found only in the southeastern United States, primarily in the southern part of the Appalachian Mountains but with a few populations farther south.Barksdale, Lane 1938. Journal of the Elisha Mitchell Scientific Society 54(2): 285Tropicos, Trillium vaseyi Harb.Biota of North America Program 2014 county distribution map Sweet wakerobin has among the largest flowers in the trillium family, with red petals up to 7 cm long. It grows in rich woods, sometimes on riverbanks but other times on steep slopes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trillium vaseyi has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

rbcLKM242982.1 ↗1 384 bp

ACGT

CAGAGACTAAAGCAAGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACACACCCAAAGATACTG …

Trillium vaseyi ribulose-1, 5-bisphosphate carboxulase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Trillium vaseyi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 101×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 022 records

Wild obs. + sensor931

Museum / vouchered78

Cultivated / captive13

Origin

Native1

Introduced1

Range

Area of Occupancy AOO1 960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 461≤1 km 89≤10 km 60>10 km 147

757 georeferenced · 174 without coordinates

Open the mapobservation + sensor931

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤1 km 22≤10 km 30>10 km 5

57 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence78

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 12 without coordinates

Open the mapnot free-living13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chapel Hill, US	13
James F. Matthews Center for Biodiversity Studieslocation not on record	10
Bloomington, US	9
Bangkok, TH	7
Knoxville, US	5
University of Tennessee at Chattanoogalocation not on record	5
Western Carolina Universitylocation not on record	4
GAlocation not on record	3
Columbia, US	3
Miami, US	3
Flagstaff, US	2
Burlington, US	2
Clemson, US	2
Kunming, CN	1
Norfolk, US	1
Beijing, CN	1
Boise, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Wuzhou, CN	1
North Carolina Museum of Natural Scienceslocation not on record	1
Long Beach, US	1
GB	1
DOI/NPS, Greenbelt Parklocation not on record	1

23 institutions · 78 of 78 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Trillium vaseyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trillium vaseyi

At a glance

Sources11 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 022 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 022 records