Trillium stamineum

Harb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Melanthiaceae/Trillium

At a glance

Occurrence records710

Data sources11

Biological traits10

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Trillium stamineum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility710 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF710 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 10

01Narrative

Trillium stamineum, the twisted trillium, also known as the Blue Ridge wakerobin, is a species of flowering plant in the family Melanthiaceae. It is native to the southeastern United States, in Alabama, Mississippi and Tennessee. Its natural habitat is calcareous woodlands. In 1901, Harbison compared T. stamineum to T. sessile. The former is distinguished by its pubescent stem, unusual petals, long erect stamens, and very short filaments.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trillium stamineum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSKC170897.1 ↗638 bp

ACGT

TCGAGATACGAAATGTGGCCGGAAGACTGTGAACTCGTGAACGAATGATCGATTCTGGTGGAGGGTTTGCCCCGAAGCCAATGCCCCCCT …

Trillium stamineum voucher TENN:Floden DNA3358 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trillium stamineum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 101×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type710 records

Wild obs. + sensor566

Museum / vouchered144

Origin

Native1

Range

Area of Occupancy AOO1 512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 347≤1 km 64≤10 km 35>10 km 55

501 georeferenced · 65 without coordinates

Open the mapobservation + sensor566

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 13≤1 km 27≤10 km 39>10 km 5

84 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence144

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tuscaloosa, US	32
Chapel Hill, US	27
Jackson, US	23
Chongqing Museumlocation not on record	20
Philadelphia, US	6
Bronx, US	4
University of Southern Mississippilocation not on record	4
Durham, US	4
Bangkok, TH	4
Mississippi State, US	3
Knoxville, US	2
James F. Matthews Center for Biodiversity Studieslocation not on record	2
Wuzhou, CN	2
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	2
GAlocation not on record	1
New Haven, US	1
Jena Microbial Resource Collectionlocation not on record	1
Columbia, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Saint Louis, US	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1
AUAlocation not on record	1
Toronto, CA	1

23 institutions · 144 of 144 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Trillium stamineum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)