Trillium smallii

Maxim. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Melanthiaceae/Trillium

At a glance

Occurrence records433

Data sources11

Biological traits9

DNA specimens5

eDNA detections5

Sources11 archives

Databases and archives Trillium smallii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility433 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS · NPASS21 compounds

Occurrence & distributionGBIF433 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB83.6 Gbp

01Narrative

Trillium smallii est une plante herbacée, vivace et rhizomateuse de la famille des liliacées ou des mélanthiacées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition21 compounds

Compounds documented for Trillium smallii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Ursane and Taraxastane triterpenoids12

Oleanane triterpenoids5

Oleanane triterpenoids $ Ursane and Taraxastane triterpenoids3

Ecdysteroids1

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
20-Hydroxyecdysone	present	LOTUS
28-O-beta-D-Glucopyranosyl pomolic acid	present	NPASS
3,23-dihydroxyurs-12,18-dien-28-O-beta-D-glucopyranosyl ester	present	NPASS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1S,4aR,6aR,6aS,6bR,8aR,10S,12aR,14bS)-1-hydroxy-1,6a,6b,9,9,12a-hexamethyl-2-methylidene-10-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-4,5,6,6a,7,8,8a,10,11,12,13,14b-dodecahydro-3H-picene-4a-carboxylate	present	NPASS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (2R,4aS,6aR,6aS,6bR,8aR,10S,12aR)-1,2,6a,6b,9,9,12a-heptamethyl-10-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-3,4,5,6,6a,7,8,8a,10,11,12,13-dodecahydro-2H-picene-4a-carboxylate	present	NPASS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (2R,4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-2,6a,6b,9,9,12a-hexamethyl-1-methylidene-10-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate	present	NPASS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (2R,4aS,6aR,6aS,6bR,8aR,9R,10S,12aR,14bS)-10-hydroxy-9-(hydroxymethyl)-2,6a,6b,9,12a-pentamethyl-1-methylidene-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate	present	NPASS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-1,2,6a,6b,9,9,12a-heptamethyl-10-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-4,5,6,6a,7,8,8a,10,11,12,13,14b-dodecahydro-3H-picene-4a-carboxylate	present	NPASS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (4aS,6aR,6aS,6bR,8aR,9R,10S,12aR,14bS)-10-hydroxy-9-(hydroxymethyl)-1,2,6a,6b,9,12a-hexamethyl-4,5,6,6a,7,8,8a,10,11,12,13,14b-dodecahydro-3H-picene-4a-carboxylate	present	NPASS
CID 16216648	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trillium smallii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences6

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC669885.1 ↗606 bpJapan

ACGT

CTGTGAAAAAGCACTGTCGGCGGAGAGACGGCGGGCGAGAGCCCTAAAACCTTTCCGCCCGTTGTGCCGAGGGAACGGCCTGCCCGGTCC …

Trillium smallii mono38 genes for ITS1, 5.8S rRNA, ITS2, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trillium smallii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size83 570 100 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Trillium smallii83.57 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidypolyploid inferred

Chromosome records20–302n range30median30mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 306×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Uchino, A. 1979. Combination of metamorphosed flowers among different shoots on a single corm of Trillium smallii Maxim. Kumamoto J. Sci., Sect. 2, Biol. 14: 17–25.

CCDB · ipcn-api-dl — Uchino, A. 1980a. Structure and dynamics of natural populations of polyploid Trillums. II. Trillium apetala - T. smallii association. Nucleus 23: 127–140.

CCDB · ipcn-api-dl — TAKAHASHI, H. 1985. Trillium x miyabeanum Tatewaki newly found in Miyagi Prefecture, Honshu. J. Japan. Bot. 60: 124–128.

CCDB · book-ipcn73-74 — HAGA, T., H. WATANABE, & H. KANAZAWA. 1974. Hybridization in natural populations of Japanese Trilliums. Jap. J. Genet. 49: 399-412.

CCDB · book-ipcn73-74 — HAGA, T., H. WATANABE, & A. UCHINO. 1974. Chromosomal polymorphism: the SU genome complex of polyploid Trilliums. Jap. J. Genet. 49: 413! 424. 1 I

CCDB · book-atlas-flowering-plants — Amano 1944

2n 202×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Starodubtsev, V. N. 1997. Chromosome numbers in some rare species of vascular plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 82(5): 121–122.

CCDB · book-atlas-flowering-plants — 1937

n 151×CCDB · Cave1958

CCDB · Cave1958 — Kurabayashi 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type433 records

Wild obs. + sensor25

Museum / vouchered407

Cultivated / captive1

Range

Area of Occupancy AOO1 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤1 km 1≤10 km 2>10 km 13

16 georeferenced · 9 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 406 without coordinates

Open the institutions mapphysical evidence407

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bando, JP	127
Odawara, JP	82
Sanda, JP	79
KURAlocation not on record	36
Chiba, JP	27
KOMlocation not on record	16
Ishikawa Museum of Natural Historylocation not on record	6
Guangzhou, CN	6
Sagamihara, JP	5
WTUlocation not on record	4
Taipei, TW	4
Burlington, US	4
Kochi, JP	3
Kew, GB	2
Vancouver, CA	1
Otaru, JP	1
Görlitz, DE	1
Karlsruhe, DE	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
Kushiro City Museumlocation not on record	1

20 institutions · 407 of 407 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Trillium smallii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)