Trillium luteum

(Muhl.) Harb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Melanthiaceae/Trillium

At a glance

Occurrence records2 128

Data sources13

Biological traits11

DNA specimens20

eDNA detections14

Sources13 archives

Databases and archives Trillium luteum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 128 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF2 128 records

Environmental DNA1 datasets · 0 countries14 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB · GoaT53.4 Gbp

01Narrative

Trillium luteum, the yellow trillium or yellow wakerobin, is a species of flowering plant in the bunchflower family Melanthiaceae with native populations in the Great Smoky Mountains of the United States and surrounding areas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trillium luteum has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes5

GenBank sequences10

eDNA detections14

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF348984.1 ↗353 bpUSA · 2015

ACGT

TGCAGAATCCCGTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGATGCCATTCGGCAGAGGGCACGCCTGCCTGGGCGTCACGTCTT …

Trillium luteum isolate AD3HK28 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Trillium luteum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size53 354 790 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Trillium luteum53.35 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidy2× diploid · measured

Chromosome records10–102n range10median10mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 103×GoaT · Kew Plant DNA C-values Database · CCDB · eflora · CCDB · Cave1956

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · eflora

CCDB · Cave1956 — Rutiahauaer

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 128 records

Wild obs. + sensor1 916

Museum / vouchered194

Cultivated / captive18

Origin

Native2

Introduced11

Range

Area of Occupancy AOO3 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 1 140≤1 km 210≤10 km 99>10 km 190

1 639 georeferenced · 277 without coordinates

Open the mapobservation + sensor1 916

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 7≤1 km 59≤10 km 63>10 km 14

143 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence194

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy8% within 1 km

≤1 km 1≤10 km 11

12 georeferenced · 6 without coordinates

Open the mapnot free-living18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Knoxville, US	79
Chapel Hill, US	16
Bloomington, US	10
Bangkok, TH	7
University of Stellenboschlocation not on record	7
James F. Matthews Center for Biodiversity Studieslocation not on record	6
College Park, US	6
Chongqing Museumlocation not on record	6
University of Tennessee at Chattanoogalocation not on record	5
Bronx, US	3
Tuscaloosa, US	3
Flagstaff, US	2
GAlocation not on record	2
Norfolk, US	2
Ann Arbor, US	2
Durham, US	2
China Agricultural Universitylocation not on record	2
BAYLUlocation not on record	2
Saint Louis, US	2
New Haven, US	1
Tampa, US	1
IPA/SPlocation not on record	1
Dekalb, US	1
Beijing, CN	1
Provo, US	1
West Virginia Wesleyan Collegelocation not on record	1
Logan, US	1
Boise, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Burlington, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Auckland, NZ	1
Tulane Universitylocation not on record	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
GB	1
AUAlocation not on record	1
Tempe, US	1
US	1
Asheville, US	1
Lord Fairfax Community Collegelocation not on record	1
McWane Science Centerlocation not on record	1
SLU Artdatabankenlocation not on record	1

42 institutions · 187 of 194 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Trillium luteum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map0 countries0

mixed deciduous forest over limestone bluff …mesic woodsflats of a streamrich woodsrich slopeMesic Woods

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trillium luteum

At a glance

Sources13 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 128 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions25 of 42 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 128 records