Trillium ludovicianum

Harb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Melanthiaceae/Trillium

At a glance

Occurrence records156

Data sources8

Biological traits10

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Trillium ludovicianum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility156 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF156 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Trillium ludovicianum, the Louisiana wakerobin or Louisiana trillium, is a species of flowering plant in the family Melanthiaceae. It is found only in the south-central United States, in Louisiana, Mississippi, and eastern Texas.Lady Bird Johnson Wildflower Center, University of Texas, Trillium ludovicianum Harbison Louisiana wakerobin, Louisiana trillium Trillium ludovicianum is a perennial herbaceous plant up to 12 inches (30 cm) tall. Flowers are dark red, purple, or dark green, sometimes with irregular markings. The plant grows in moist woods and floodplains.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trillium ludovicianum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSKC170881.1 ↗632 bp

ACGT

TCGAGATACGAAATGTGGCCGGAAGATGTGAACTCGTGAACGAATGATCGATTCTGGTGGAGGGTTTGTCCCGAAGCCAATGCCCCTGCC …

Trillium ludovicianum voucher TENN:Mellard DNA719 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type156 records

Wild obs. + sensor116

Museum / vouchered40

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 29≤1 km 7≤10 km 11>10 km 15

62 georeferenced · 54 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤1 km 3≤10 km 12>10 km 11

26 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BAYLUlocation not on record	9
Philadelphia, US	7
Chongqing Museumlocation not on record	6
US	4
Bronx, US	3
Bangkok, TH	3
Columbia, US	2
Flagstaff, US	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Jackson, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Auckland, NZ	1
Fort Worth, US	1

13 institutions · 40 of 40 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Trillium ludovicianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)