Trillium flexipes

Raf. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Melanthiaceae/Trillium

At a glance

Occurrence records4 229

Data sources13

Biological traits19

DNA specimens7

eDNA detections5

Sources13 archives

Databases and archives Trillium flexipes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF4 229 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT47.7 Gbp

01Narrative

Trillium flexipes, known as the nodding wakerobin, bent trillium, or drooping trillium, is a species of flowering plant in the family Melanthiaceae. It is found from Minnesota to Ohio, south to Tennessee, with isolated (and sometimes rare) populations in New York, Pennsylvania, Alabama, and other states. It is an endangered species in Ontario and possibly extirpated in North Carolina.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.43 m

Plant height generative0.4 m

Life cycle & reproduction5

Flowering endMay

Flowering startApr

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry5

Leaf dry-matter content (LDMC)154 mg/g

Leaf n49.35 mg/g

Leaf p2.45 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)35.48 mm²/mg

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trillium flexipes has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG216641.1 ↗353 bpCanada · 1950

ACGT

TGCAGAATCCCGTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGATGCCATTCGGCTGAGGGCACGCCTGCTTGGGCGTCACGCCTT …

Trillium flexipes voucher CCDB-18296-D04 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Trillium flexipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size47 662 830 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Trillium flexipes47.66 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidy2× diploid · measured

Chromosome records10–102n range10median10mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 105×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn67-71 · CCDB · eflora +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn67-71 — SEROTA, C. A., & B. W. SMITH. 1967. The cytoecology of four species of Trillium from western North Carolina. Am. Jour. Bot. 54: 169-181.

CCDB · book-ipcn67-71 — SEROTA, c. A., & H.B. GRYDER. 1967. A morphological and karyotypic analysis of an isolated population of Trillium gleasoni Fern. Jour. Elisha Mitchell Sci. Soc. 83: 117-122 ..

CCDB · eflora

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 229 records

Wild obs. + sensor3 715

Museum / vouchered501

Cultivated / captive13

Origin

Native1

Introduced11

Range

Area of Occupancy AOO7 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 1 655≤1 km 621≤10 km 171>10 km 709

3 156 georeferenced · 559 without coordinates

Open the mapobservation + sensor3 715

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 20≤1 km 173≤10 km 162>10 km 26

381 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence501

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 11

11 georeferenced · 2 without coordinates

Open the mapnot free-living13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Madison, US	127
Bloomington, US	113
Chongqing Museumlocation not on record	38
Ann Arbor, US	33
International Salmonella Centre (W.H.O.)location not on record	25
Millersville, US	21
Knoxville, US	18
Saint Louis, US	14
Dekalb, US	11
Chicago, US	9
Waverly, US	7
Museum of the Rockieslocation not on record	7
James F. Matthews Center for Biodiversity Studieslocation not on record	6
DOI/NPS, Selma to Montgomery National Historic Traillocation not on record	6
University of Tennessee at Chattanoogalocation not on record	5
Wuzhou, CN	4
University of Wisconsinlocation not on record	3
DOI/NPS, Greenbelt Parklocation not on record	3
Flagstaff, US	3
Columbia, US	3
Tampa, US	3
Whitewater, US	3
BAYLUlocation not on record	3
Northridge, US	2
Decorah, US	2
Portland, US	2
Chicago, US	2
Auckland, NZ	2
San Luis Obispo, US	2
US	1
Shanghai Chenshan Botanical Gardenlocation not on record	1
Denver, US	1
University of Stellenboschlocation not on record	1
Tall Timbers Research Stationlocation not on record	1
New Haven, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
IPA/SPlocation not on record	1
Chapel Hill, US	1
San Angelo, US	1
AUAlocation not on record	1
Pullman, US	1
Burlington, US	1
Richmond, US	1
Tennessee Technological Universitylocation not on record	1
McWane Science Centerlocation not on record	1
Jena Microbial Resource Collectionlocation not on record	1
Bangkok, TH	1
Bronx, US	1
University of Wisconsinlocation not on record	1

49 institutions · 497 of 501 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Trillium flexipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

Rocky woods.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trillium flexipes

At a glance

Sources13 archives

Size & morphology2

Life cycle & reproduction5

Diet & foraging1

Habitat & environment6

Physiology & chemistry5

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type4 229 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions30 of 49 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 229 records