Trillium chloropetalum

(Torr.) Howell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Melanthiaceae/Trillium

At a glance

Occurrence records4 325

Data sources13

Biological traits14

DNA specimens5

eDNA detections6

Sources13 archives

Databases and archives Trillium chloropetalum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 325 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF4 325 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT53.7 Gbp

01Narrative

Trillium chloropetalum, also known as giant trillium, giant wakerobin, or common trillium, is a species of flowering plant in the family Melanthiaceae. It is endemic to the western U.S. state of California, being especially frequent in and around the San Francisco Bay Area.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass46.34 mg

Seed mass max46.34 mg

Seed mass min46.34 mg

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trillium chloropetalum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences9

eDNA detections6

The DNA barcodea real sequence read deposited for this species

ITSAB018809.1 ↗636 bp

ACGT

TCGAGATACGAAATGTGGCCGGAAGACTGTGAACTCGTGAACGAATGATCGATTCTGGTGGAGGGTTTGTCCCGAAGCCAATGCCCCTGC …

Trillium chloropetalum genes for ITS1, 5.8S rRNA, ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Trillium chloropetalum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size53 701 980 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Trillium chloropetalum53.7 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidy2× diploid · measured

Chromosome records10–102n range10median10mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 103×GoaT · Kew Plant DNA C-values Database · CCDB · eflora · CCDB · book-atlas-flowering-plants

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · eflora

CCDB · book-atlas-flowering-plants — Warmke 1937

n 52×CCDB · book-ipcn67-71 · CCDB · Cave1962

CCDB · book-ipcn67-71 — CAVE, M.S. 1970. Chromosomes of California Liliaceae. Univ. Calif. Publ. Bot. 57: 1-58.

CCDB · Cave1962 — Berg 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 325 records

Wild obs. + sensor4 076

Museum / vouchered246

Cultivated / captive3

Origin

Introduced1

Range

Area of Occupancy AOO2 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 2 506≤1 km 445≤10 km 220>10 km 109

3 280 georeferenced · 796 without coordinates

Open the mapobservation + sensor4 076

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 13≤1 km 50≤10 km 80>10 km 19

162 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence246

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Angwin, US	33
Santa Barbara, US	13
Davis, US	13
San Francisco, US	12
Arcata, US	12
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	11
Tacoma, US	8
US	6
San Jose, US	6
San Luis Obispo, US	4
Long Beach, US	4
Pacific Lutheran Universitylocation not on record	4
San Diego, US	4
Riverside, US	4
Northridge, US	3
Turlock, US	3
Moscow, US	3
Portland, US	2
Santa Cruz, US	2
CASlocation not on record	2
Canadian Department of Agriculturelocation not on record	2
SLU Artdatabankenlocation not on record	2
Pullman, US	2
Auckland, NZ	2
Columbia, US	1
Nantes Culture Collectionlocation not on record	1
Chongqing Museumlocation not on record	1
Portland, US	1
Corvallis, US	1
Claremont, US	1
Logan, US	1
STNFlocation not on record	1
KNFSClocation not on record	1
Henderson, US	1
Victoria, CA	1
Bangkok, TH	1

36 institutions · 169 of 246 vouchered records shown · 77 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Trillium chloropetalum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trillium chloropetalum

At a glance

Sources13 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type4 325 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions27 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 325 records