Trillium camschatcense
Ker Gawl. · speciesAt a glance
Occurrence records865
Data sources13
Biological traits30
DNA specimens5
eDNA detections5
Sources13 archives
Databases and archives Trillium camschatcense's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility865 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics5 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources30 traits
Chemical compositionLOTUS · NPASS132 compounds
Occurrence & distributionGBIF865 records
Environmental DNA1 datasets · 0 countries5 detections
DNA & barcodingBOLD · NCBI5 specimens
Genome at a glanceCCDB · GoaT46.6 Gbp
01Narrative
Trillium camschatcense est une plante herbacée, vivace et rhizomateuse de la famille des liliacées ou des mélanthiacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology14
Fruit length23 mm
Fruit length max28 mm
Fruit length min18 mm
Fruit width23 mm
Fruit width max28 mm
Fruit width min18 mm
Leaf length135 mm
Leaf length max170 mm
Leaf length min100 mm
Leaf width max170 mm
Leaf width min70 mm
Plant height0.425 m
Plant height max0.5 m
Plant height min0.15 m
Life cycle & reproduction5
Flowering endJun
Flowering startMay
Life formrhizomatous geophyte
Life spanperennial
Raunkiær life formcryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Climatetemperate
Climberself-supporting
Elevation max1 400 m
Elevation mean950 m
Elevation min500 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTConiferous woods, in moss-covered soil.
Woodinessnon-woody
Other traits1
Plant support typefree-standing
03Chemical composition132 compounds
Compounds documented for Trillium camschatcense across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Spirostane steroids32
Carotenoids (C40, β-β)10
Furostane steroids5
Aminoacids4
Cinnamic acids and derivatives4
Documented compounds132 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R)-3,5,5-trimethyl-4-[(3E,5E,7E,9E,11E,13E,15E,17E)-3,7,12,16-tetramethyl-18-[(1R)-2,6,6-trimethylcyclohex-2-en-1-yl]octadeca-3,5,7,9,11,13,15,17-octaen-1-ynyl]cyclohex-3-en-1-ol | present | NPASS | |
| (1R,2S,3'S,4R,4'S,5'S,6S,7R,8R,9R,12S,13R,14R,16R)-14-[(2S,3R,4S,5S)-3-[(2S,3R,4R,5S,6S)-4-[(2S,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-3,5-dihydroxy-6-methyloxan-2-yl]oxy-5-hydroxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-3',4',16-trihydroxy-7-(hydroxymethyl)-5',9,13-trimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-3-one | present | LOTUS | |
| (1R,2S,4S,4'S,5'S,6R,7S,8S,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-4',8,16-triol | present | LOTUS | |
| (1R,3'S,4R,4'R,5'S,6S,7R,8R,12S,13R,14R,16R)-14-[(2S,3R,4S,5S)-3-[(2S,3R,4R,5S,6S)-4-[(2S,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-3,5-dihydroxy-6-methyloxan-2-yl]oxy-5-hydroxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-3',4',16-trihydroxy-7-(hydroxymethyl)-5',13-dimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosa-2(9),18-diene-6,2'-oxane]-3-one | present | LOTUS | |
| (1R,3'S,4R,4'R,5'S,6S,7R,8R,12S,13R,14R,16R)-14-[(2S,3R,4S,5S)-4,5-dihydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3',4',16-trihydroxy-7-(hydroxymethyl)-5',13-dimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosa-2(9),18-diene-6,2'-oxane]-3-one | present | LOTUS | |
| (1R,3'S,4R,4'R,5'S,6S,7R,8R,12S,13R,14R,16R)-3',4',14,16-tetrahydroxy-7-(hydroxymethyl)-5',13-dimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosa-2(9),18-diene-6,2'-oxane]-3-one | present | LOTUS | |
| (1R,3'S,4R,4'R,5'S,6S,7R,8R,12S,13R,14R,16R)-3',4',16-trihydroxy-7-(hydroxymethyl)-14-[(2S,3R,4S,5S)-5-hydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5',13-dimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosa-2(9),18-diene-6,2'-oxane]-3-one | present | LOTUS | |
| (1R,3'S,4R,4'R,5'S,6S,7S,8R,12S,13R,14R,16R)-3',4',16-trihydroxy-14-[(2S,3R,4S,5S)-5-hydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5',7,13-trimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosa-2(9),18-diene-6,2'-oxane]-3-one | present | LOTUS | |
| (1R,3'S,4R,4'S,5'S,6S,7R,8R,12S,13R,14R,16R)-14-[(2S,3R,4S,5S)-3-[(2S,3R,4R,5S,6S)-4-[(2S,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-3,5-dihydroxy-6-methyloxan-2-yl]oxy-5-hydroxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-3',4',16-trihydroxy-7-(hydroxymethyl)-5',13-dimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosa-2(9),18-diene-6,2'-oxane]-3-one | present | LOTUS | |
| (1S,2S,3'S,4S,4'S,5'S,6S,7R,8R,9S,12S,13R,14R,16R)-14-[(2S,3R,4S,5S)-3-[(2S,3R,4R,5S,6S)-4-[(2S,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-3,5-dihydroxy-6-methyloxan-2-yl]oxy-5-hydroxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-7-(hydroxymethyl)-5',9,13-trimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-3',4',16-triol | present | LOTUS |
05DNA & barcoding5 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trillium camschatcense has left across the world's sequence archives.
At a glance
DNA specimens5
Marker genes4
GenBank sequences10
eDNA detections5
Countries1
The DNA barcodea real sequence read deposited for this species
TCGAGATACGAAATGTGGTCGGAAGACTGTGAACTCGTGAACGAAATAATCGATTTTGGTGGAGGGTTCGTCCCGAAGCCAATGCCTCTG …
Trillium camtschatcense genes for ITS1, 5.8S rRNA, ITS2
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Trillium camschatcense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size46 555 694 081 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Trillium camschatcense46.56 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Ploidy2× diploid · measured
Chromosome records10–302n range10median10mode29records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1028×GoaT · Kew Plant DNA C-values Database · CCDB · iapt · CCDB · book-ipcn65 +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · book-ipcn65 — Sokolovskaya 1965
CCDB · ipcn-api-dl — Grif, V. G., S. K. Cherepanov, E. M. Valovich & N. N. Belyayeva. 1985. Biosystematics of some species of the genus Trillium (Trilliaceae) in the USSR. Bot. Zhurn. SSSR 70(9): 1177–1186.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaya & E. G. Rudyka. 1989. Chromosome numbers in some species of vascular plants from Kunashir Island (the Kuril Islands). Bot. Žhurn. (Moscow & Leningrad) 74: 1675–1678.
CCDB · ipcn-api-dl — Belaeva, N. N. 1989. Variabilnost differencialnykh segmentov u Trillium camschatcense Ker-Gawl. Sovetskogo Sojusa. Pp. 39--41 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Fukuda, I., J. D. Freeman & M. Itou. 1996. Trillium channellii, sp. nov. (Trilliaceae), in Japan, and T. camschatcense Ker Gawler, correct name for the Asiatic diploid Trillium. Novon 6(2): 164–171.
CCDB · ipcn-api-dl — Myakoshina, Y. A., E. O. Punina & A. V. Rodionov. 2002. Ag-NO staining of transcriptionally active nucleolus organizers in the karyotypes of the plants of the family Trilliaceae. Citologija 44(9): 894–895.
CCDB · ipcn-api-dl — Punina, E. O. 1997. Chromosome banding of the euchromatic regions of the Trillium camschatcense prometaphase chromosomes obtained by cold exposition and acridine orange staining. Pages 131--132 in Agrobiotechnology of Plants and Animals. Kiev.
CCDB · ipcn-api-dl — Rudyka, E. G. 1998. Chromosome numbers of the monocotyledonous plants of the flora of Russian Far East. Pages 135--137 in Rasteniya v Mussonnom Klimate. Vladivostok.
CCDB · ipcn-api-dl — Ohara, M. & S. Kawano. 2005. Life-history monographs of Japanese plants. 2. Trillium camschatcense Ker-Gawl. (Trilliaceae). Pl. Spec. Biol. 20: 75–82.
CCDB · ipcn-api-dl — Fukuda, I. & Y. Horii. 2004. Population dynamics of Trillium species in Tohoku district in Japan. Bunrui 4: 117–123.
CCDB · ipcn-api-dl — Punina. 2005. Karyosystematics and molecular phylogeny of Trilliaceae. Biol. Membrany 22: 249–257.
CCDB · ipcn-api-dl — Myakoshina. 2006. Karyosystematic study of some Trilliaceae Cheval. In Thesis Diss. Cand. Biol. Sci. St. Petersburg.
CCDB · book-ipcn72 — KAYANO, H. 1972. Crossing-over as a cause of diversification of patterns of H-segments in Trillium kamtschaticum. Jap. J. Genet. 47: 219-221.
CCDB · book-ipcn67-71 — KAYANO, H., & H. WATANABE. 1970. Panmixis in natural populations of Trillium kamtschaticum. Jap. J. Genet. 45: 59-69.
CCDB · book-ipcn67-71 — FUKUDA, I. 1967. The formation of subgroups by the development of inbreeding systems in a Trillium population. Evolution 21: 141-147.
CCDB · book-ipcn73-74 — UCHINO, A. 1973. A spontaneous haploid plant of Trillium smallii. Jap. J. Genet. 48(1): 65-67.
CCDB · book-ipcn73-74 — FUKUDA, I. 1970. Chromosome compositions of the southern populations: in Trillium kamtschaticum. Sci. Rep. Tokyo Woman's Christian Call. 12 14: 159 174. I
CCDB · book-ipcn73-74 — FUKUDA, I., & Y. KOZUKA. 1958. Evolution and variation in Trillium. A list of chromosome composition in natural populations of Trillium kamtschaticum Pall. J. Fac. Sc1. Hokka1do Un1v., Ser. 5, Bot. 6: 273- I 319. 1
CCDB · book-ipcn73-74 — HAGA, T., H. WATANABE, & H. KANAZAWA. 1974. Hybridization in natural populations of Japanese Trilliums. Jap. J. Genet. 49: 399-412.
CCDB · book-ipcn73-74 — TANAKA, R. 1974. Organizational system of meiotic division and the development of reproductive cells in higher plants. The Cell 6: 22-25
CCDB · eflora
CCDB · book-atlas-flowering-plants — Haga 1937a
CCDB · kew — Grif VG, Valovich EM, Lebedeva NV. 1980. Parameters of the mitotic cycle in two species of Trillium L. Tsitologiya 22: 1331-1338.
CCDB · Cave1962 — Fukuda 1962
CCDB · Cave1963 — Tamura 1963
CCDB · Cave1963 — Sokolovskaya 1963
2n 301×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Hong, D. y. & W. Sauer. 1990. Cytotaxonomical studies of the Liliaceae (s.l.) in the Changbai Mountains of northeastern China. Cathaya 2: 151–164.
n 58×CCDB · book-ipcn65 · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +4
CCDB · book-ipcn65 — Liu 1965a, b; Ohno 1965
CCDB · book-ipcn66 — Tanifugi & Ochiai 1966; Tanifugi et al. 1966
CCDB · book-ipcn67-71 — LIU, I., & H. MATSUURA. 1967. The effect of low temperature treatment on meiotic chromosomes in Trillium kamtschaticum Pall. Jap. Jour. Genet. 42: 67-74.
CCDB · book-ipcn67-71 — MASUBUCHI, N. 1967. The structure of pachytene chromosomes in Trillium kamtschaticum Pall. La Kromosomo 68: 2229-2234.
CCDB · book-ipcn75-78 — Kanazawa 1977
CCDB · Cave1958 — Hag.&Kur. '54;Kur. 158
CCDB · Cave1962 — Takizawa 1962
CCDB · Cave1963 — Tamura 1963
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type865 records
Wild obs. + sensor676
Museum / vouchered182
Cultivated / captive7
Origin
Native2
Introduced6
Range
Area of Occupancy AOO2 216 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy64% within 1 km
≤100 m 264≤1 km 59≤10 km 46>10 km 132
501 georeferenced · 175 without coordinates
Open the mapobservation + sensor676
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy32% within 1 km
≤100 m 1≤1 km 10≤10 km 21>10 km 2
34 georeferenced · 148 without coordinates
Open the institutions mapphysical evidence182
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 6
6 georeferenced · 1 without coordinates
Open the mapnot free-living7
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions10 of 27 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 36 |
| KIRMlocation not on record | 32 |
| Tsukuba, JP | 15 |
| Kushiro City Museumlocation not on record | 13 |
| KR | 11 |
| Nagano City, JP | 9 |
| Otaru, JP | 8 |
| Toyama, JP | 8 |
| Sendai, JP | 8 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 7 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 4 |
| Fukushima Universitylocation not on record | 4 |
| Nanjing, CN | 4 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 3 |
| Obihiro Centennial City Museumlocation not on record | 2 |
| Korea National Arboretumlocation not on record | 2 |
| Olocation not on record | 2 |
| WTUlocation not on record | 2 |
| Kew, GB | 2 |
| Kyoto Universitylocation not on record | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Provincia di Livornolocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Sapporo, JP | 1 |
| IWEP FEB RASlocation not on record | 1 |
| South Kensington, GB | 1 |
| DNSMlocation not on record | 1 |
27 institutions · 182 of 182 vouchered records shown
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA5 detections
Where the DNA of Trillium camschatcense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found5
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 5 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.