Trigonella suavissima

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trigonella

At a glance

Occurrence records1 060

Data sources8

Biological traits38

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Trigonella suavissima's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 060 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Occurrence & distributionGBIF1 060 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Trigonella suavissima is a herbaceous plant that is endemic to Australia. It is a member of the genus Trigonella and the family Fabaceae. Common names include Cooper clover, Menindee clover, calomba, Darling trigonella, sweet fenugreek, channel clover, sweet-scented clover and Australian shamrock. The species was formally described by English botanist John Lindley, based on plant material collected during an expedition by Thomas Mitchell.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length12 mm

Fruit width2 mm

Leaf length8 mm

Leaf length max20 mm

Leaf length min4 mm

Leaf size16 mm²

Leaf width7.5 mm

Leaf width max15 mm

Leaf width min2 mm

Petiole length4 cm

Plant height0.5 m

⚠ sources differ — AusTraits: 0.5 m · TRY: 0.8 m

Plant height max0.3 m

Seed length1 mm

Seed mass0.563 mg

⚠ sources differ — TRY: 0.563 mg · AusTraits: 0.888 mg · GIFT: 10.75 mg

Seed mass max10.75 mg

Seed mass min10.75 mg

Life cycle & reproduction8

Dehiscencedehiscent

Dispersal typeanimal

Flowering timennyyyyyynnnn

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formherb

Leaf compoundnesscompound

Leaf shapeobcordate obovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trigonella suavissima has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX274131.1 ↗713 bpAustralia

ACGT

CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAATCCAACACGCGAATCAGTTTGAACACATAG …

Trigonella suavissima isolate EC 583625 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type1 060 records

Wild obs. + sensor427

Museum / vouchered628

Other5

Origin

Native229

Introduced1

Range

Area of Occupancy AOO3 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 299≤1 km 46≤10 km 44>10 km 1

390 georeferenced · 37 without coordinates

Open the mapobservation + sensor427

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 108≤1 km 129≤10 km 290>10 km 56

583 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence628

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	202
Canberra, AU	83
Mount Annan, AU	69
Brisbane, AU	61
Palmerston, AU	58
Museo Entomologico de Leonlocation not on record	57
Kensington, AU	34
Armidale, AU	10
Kew, GB	8
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Hobart, AU	3
Parkville, AU	3
Stockholm, SE	2
Smithfield, AU	2
EL PASO, US	1
Wellington, NZ	1
Auckland, NZ	1

17 institutions · 599 of 628 vouchered records shown · 29 without an institution code

09Environmental DNA1 detections

Where the DNA of Trigonella suavissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trigonella suavissima

At a glance

Sources8 archives

Size & morphology16

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type1 060 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 060 records