Trigonella caerulea

(L.) Ser. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trigonella

At a glance

Occurrence records601

Data sources13

Biological traits25

DNA specimens5

eDNA detections4

Sources13 archives

Databases and archives Trigonella caerulea's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility601 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionLOTUS · NPASS17 compounds

Occurrence & distributionGBIF601 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trigonella caerulea - MHNT Trigonella caerulea (blue fenugreek, blue melilot, - ulumbo, utskho suneli)) is an annual herb in the family Fabaceae. It is 30–60 cm tall. Its leaves are obovate or lance-shaped, 2–5 cm long, 1–2 cm wide and saw-toothed in upper part. Its flower stalks are compact, globular racemes, longer than the leaves. The sepals are twice as short as the corolla, its teeth are equal to the tube. The corolla is 5.5-6.5 mm long and blue. The pods are erect or slightly curved, compressed, 4–5 mm long with beak 2 mm. The seeds are small and elongated. It blossoms in April–May, the seeds ripen in May–June. It is self-pollinated.AgroAtlas, accessed 29 July 2013.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Plant height0.45 m

⚠ sources differ — GIFT: 0.45 m · TRY: 0.588 m

Plant height max0.6 m

Plant height min0.3 m

Seed length2.1 mm

Seed mass2.41 mg

Seed mass max2.3 mg

Seed mass min2.3 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering endJul

Flowering startJun

Life formannual

Life spanannual

Lifespan years1 years

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTcrop fields, roadsides

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits2

Diaspore typeseed

Shoot orientationerect

03Chemical composition17 compounds

Compounds documented for Trigonella caerulea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking🌿 Spice🌿 Tea

Compound class profile5 classes

Stigmastane steroids4

Cholestane steroids3

Flavonols2

Cholestane steroids $ Ergostane steroids2

Spirostane steroids2

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,8S,9S,10R,13S,14S,17R)-10,13-dimethyl-17-[(Z,2R)-5-propan-2-ylhept-5-en-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
24-Methylcholesterol	present	LOTUS
24-Methylenecholesterol	present	LOTUS
5-Dehydroavenasterol	present	LOTUS
Agrocybin	present	NPASS
beta-Sitosterol	present	LOTUS
Campest-7-en-3-ol	present	LOTUS
Cholesterol	present	LOTUS
Diosgenin	present	LOTUS
Fucosterol	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trigonella caerulea has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences7

eDNA detections4

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMG236948.1 ↗316 bpCanada · 1937

ACGT

AAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACATATCGAAGCCTCTTGCCAATCTCCTTTCAATAATGGGTA …

Trigonella caerulea voucher CCDB-20332-G06 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trigonella caerulea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 166×CCDB · nw-europe-fl · CCDB · poland · CCDB · ipcn-api-dl +3

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2944

CCDB · poland — Bijok K. 1962. Badania kariologiczne nad.gatunkami Melilotus albus Med., Melilolus officinalis (L.) Lam. em. Thuil. i Trigonella coerulea Ser. (L.) Ser. Zesz. Nauk. WSR Olsztyn 14, 377-383.

CCDB · ipcn-api-dl — Liu, Y. 1984. Karyotype comparative studies of nine species on Melilotus. Bull. Bot. Res., Harbin 4: 145–157.

CCDB · book-ipcn67-71 — SINGH, A., & R.P. ROY. 1970. Karylogical studies in Triqonella, Indiqofera, and Phaseolus. Nucleus 13: 41-54.

CCDB · book-atlas-flowering-plants — Fryer 1930

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

n 81×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — SINGH, A., & R-.P. ROY. 1971. Studies on the colchiploids of 531 four species of Trigonella. Cytologia 36: 133-142.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type601 records

Wild obs. + sensor324

Museum / vouchered261

Cultivated / captive5

Other11

Origin

Introduced51

Range

Area of Occupancy AOO1 604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 33≤1 km 102≤10 km 122>10 km 15

272 georeferenced · 52 without coordinates

Open the mapobservation + sensor324

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 9≤1 km 55≤10 km 47>10 km 23

134 georeferenced · 127 without coordinates

Open the institutions mapphysical evidence261

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 51 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	42
MeiseBGlocation not on record	26
Moscow State Universitylocation not on record	19
Helsinki, FI	13
Bern, CH	11
BFLlocation not on record	10
Oskarshamn, SE	9
BRNUlocation not on record	8
South Kensington, GB	5
BSBIlocation not on record	4
Mlocation not on record	4
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	3
SLU Artdatabankenlocation not on record	3
Oulu, FI	3
Turku, FI	3
Lausanne, CH	2
TUR-Alocation not on record	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Chongqing Museumlocation not on record	2
Porrentruy, CH	2
Philadelphia, US	2
GJOlocation not on record	2
Bourges, FR	2
Uniwersytet Wrocławskilocation not on record	2
Philadelphia, US	2
Regensburgische Botanische Gesellschaftlocation not on record	1
Görlitz, DE	1
Bergen, NO	1
Brussel, BE	1
Miami, US	1
Frauenfeld, CH	1
Barcelona, ES	1
Berlin, DE	1
Karlsruhe, DE	1
Natural History Museum Rotterdamlocation not on record	1
Zürich, CH	1
Tianjin Natural History Museumlocation not on record	1
Jyväskylä, FI	1
Tartu, EE	1
Université Lavallocation not on record	1
Wlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Saint Louis, US	1
Uppsala, SE	1
Porvoo, FI	1
Trondheim, NO	1
Voronezh State Universitylocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Québec, CA	1
Beijing, CN	1
Provincia di Livornolocation not on record	1

51 institutions · 209 of 261 vouchered records shown · 52 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Trigonella caerulea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

Between rows of cultivated grass.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)