Trifolium tomentosum
speciesAt a glance
Occurrence records12 356
Data sources13
Biological traits54
DNA specimens5
eDNA detections2
Sources13 archives
Databases and archives Trifolium tomentosum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility12 356 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics5 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources54 traits
Chemical compositionLOTUS3 compounds
Occurrence & distributionGBIF12 356 records
Environmental DNA1 datasets · 1 countries2 detections
DNA & barcodingBOLD · NCBI5 specimens
Genome at a glanceCCDB · GoaT508 Mbp
01Narrative
Le Trèfle cotonneux est une espèce de plantes annuelles de la famille des Fabacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDAGIFTWCVPAusTraitsTRY
Size & morphology20
Fruit length1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 3 mm
Leaf length9.5 mm
Leaf length max30 mm
Leaf length min4 mm
Leaf width5.5 mm
Leaf width max15 mm
Leaf width min2 mm
Plant height0.16 m
⚠ sources differ — AusTraits: 0.16 m · TRY: 0.046 m
Plant height max0.3 m
Plant height min0.02 m
Seed length1.3 mm
Seed mass0.576 mg
Seed mass max0.73 mg
Seed mass min0.47 mg
Seed volume0.53 mm³
Seed volume max0.53 mm³
Seed volume min0.53 mm³
Seed width1.5 mm
Seed width max1.5 mm
Seed width min1.5 mm
Life cycle & reproduction13
Dispersal typeanimal
Flower colourpink
Flower length max5 mm
Flower length min3 mm
Flowering endApr
Flowering startApr
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
Growth formherb
Habitat GIFTLowland
Leaf compoundnesscompound
Leaf formobovate
Leaf shapeobovate
Woodinessnon-woody
Physiology & chemistry3
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)27.24 mm²/mg
Other traits3
Shoot length max35 cm
Shoot length min5 cm
Shoot orientationprostrate
03Chemical composition3 compounds
Compounds documented for Trifolium tomentosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Pterocarpan3
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| 9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol | present | LOTUS | |
| Medicarpin | present | LOTUS |
05DNA & barcoding5 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium tomentosum has left across the world's sequence archives.
At a glance
DNA specimens5
Marker genes4
GenBank sequences6
eDNA detections2
Countries3
The DNA barcodea real sequence read deposited for this species
TCGATGCCTTACATGCAGACCAACACGTGAATCAGTTTGAACACATATGGTTGGCTTTCGGAGGTGCATTCGACACCTCGGCGTCTTGCC …
Trifolium tomentosum voucher MF20 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★rbcLa★ITS4
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Trifolium tomentosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size507 582 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium tomentosum0.51 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–162n range16median16mode38records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1638×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · nw-europe-fl +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 252: 79-164(1978).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Estudio biosistemtico de Trifolium sect. Vesicastrum en la Pennsula Ibrica. Muoz Rodrguez, A. F.Stud. Bot. Univ. Salamanca11: 259-295(1993).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2967
CCDB · mediterranean
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. F. 1993. Estudio biosistemático de Trifolium sect. Vesicastrum en la Península Ibérica. Stud. Bot. Univ. Salamanca 11: 259–295.
CCDB · ipcn-api-dl — Badr, A. 1995. Electrophoretic studies of seed proteins in relation to chromosomal criteria and the relationships of some taxa of Trifolium. Taxon 44: 183–191.
CCDB · ipcn-api-dl — Slavĭk, B., V. Jarolĭmovă & J. Chrtek. 1993. Chromosome counts of some plants from Cyprus. Candollea 48(1): 221–230.
CCDB · ipcn-api-dl — Oberprieler, C. & R. Vogt. 1996. Chromosome numbers of North African phanerogams. VI. Some counts in Leguminosae. Willdenowia 25: 669–680.
CCDB · ipcn-api-dl — Issolah, R. & A. Abdelguerfi. 1999. Chromosome numbers within some spontaneous populations of 10 Trifolium species in Algeria. Caryologia 52: 151–154.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · book-ipcn67-71 — PRITCHARD, A.J. 1969. Chromosome numbers in some species of Trifoli Austral. J. Agric. Res. 20: 883-887.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn75-78 — Fernandes
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · kew — Vižintin L, Javornik B, Bohanec B. 2006. Genetic characterization of selected Trifolium species as revealed by nuclear DNA content and ITS rDNA region analysis. Plant Science 170: 859-866.
CCDB · Cave1956supp — Ahuja 1955
CCDB · CromoCat 2015 — Badr, A. (1995). Electrophoretic studies of seeds proteins in relation to chromososmal criteria and the relationships of some taxa of Trifolium Taxon 44(2): 183-191.
CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.
CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Muñoz Rodríguez, A. F. (1993b). Estudio biosistemático de Trifolium sect. Vesicastrum en la Península Ibérica. Stud. Bot. Univ. Salamanca 11: 259-295.
CCDB · CromoCat 2015 — Oberprieler, C. & R. Vogt. (1994). Reports (294-312). Fl. Medit. 4: 262-269.
CCDB · CromoCat 2015 — Pritchard, A. J. (1969). Chromosome numbers in some species of Trifolium. Austral. J. Agric. Res. 20: 883-887.
CCDB · CromoCat 2015 — Runemark, H. (2006). Reports (1473-1571). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 408-425
CCDB · CromoCat 2015 — Slavík, B., V. Jarolímová & J. Chrtek. (1993). Chromosome counts of some plants from Cyprus. Candollea 48(1): 221-230.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.984 ↗
08Occurrence & distribution
Record type12 356 records
Wild obs. + sensor9 342
Museum / vouchered2 172
Cultivated / captive210
Other632
Origin
Native185
Introduced1 306
Range
Area of Occupancy AOO29 296 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 3 308≤1 km 918≤10 km 2 541>10 km 163
6 930 georeferenced · 2 412 without coordinates
Open the mapobservation + sensor9 342
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 154≤1 km 339≤10 km 443>10 km 30
966 georeferenced · 1 206 without coordinates
Open the institutions mapphysical evidence2 172
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 82>10 km 26
108 georeferenced · 102 without coordinates
Open the mapnot free-living210
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions71 of 111 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 268 |
| LDlocation not on record | 196 |
| Adelaide, AU | 161 |
| Museo Entomologico de Leonlocation not on record | 138 |
| BIO-UNIPIlocation not on record | 127 |
| Mount Annan, AU | 81 |
| Badajoz, ES | 74 |
| MAlocation not on record | 74 |
| Kensington, AU | 53 |
| CICYTEXlocation not on record | 52 |
| BClocation not on record | 51 |
| València, ES | 45 |
| Canberra, AU | 43 |
| ISAlocation not on record | 40 |
| Córdoba, ES | 38 |
| College of the Atlantic, Museumlocation not on record | 34 |
| Madrid, ES | 27 |
| Granada, ES | 26 |
| Entomological Society of Latvialocation not on record | 26 |
| Hobart, AU | 24 |
| Christchurch, NZ | 23 |
| Wlocation not on record | 22 |
| BDBClocation not on record | 21 |
| Salamanca, ES | 21 |
| Vitoria, ES | 19 |
| Armidale, AU | 16 |
| Phyletisches Museum Jenalocation not on record | 15 |
| Canadian Department of Agriculturelocation not on record | 15 |
| Davis, US | 14 |
| Barcelona, ES | 13 |
| Brisbane, AU | 13 |
| UIBlocation not on record | 13 |
| BRNUlocation not on record | 11 |
| Alicante, ES | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| CJBGlocation not on record | 10 |
| Sevilla, ES | 9 |
| UChlocation not on record | 9 |
| South Kensington, GB | 8 |
| Riverside, US | 8 |
| San Sebastián, ES | 8 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 8 |
| Philadelphia, US | 7 |
| ESP010location not on record | 7 |
| Jaén, ES | 7 |
| Auckland, NZ | 7 |
| Santiago de Compostela, ES | 6 |
| Coimbra, PT | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Pretoria, ZA | 6 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 6 |
| Moscow State Universitylocation not on record | 6 |
| CASlocation not on record | 5 |
| Claremont, US | 5 |
| Frankfurt am Main | 5 |
| Kew, GB | 5 |
| Cape Town, ZA | 5 |
| PRT004location not on record | 5 |
| Santa Cruz, US | 5 |
| Pamplona, ES | 4 |
| Parkville, AU | 4 |
| Pullman, US | 4 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| Valparaiso, CL | 4 |
| MeiseBGlocation not on record | 4 |
| Paris, FR | 4 |
| Bourges, FR | 3 |
| Hunan Geological Museumlocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Rishon Le Zion, IL | 3 |
| Oskarshamn, SE | 3 |
| Odawara, JP | 3 |
| PRClocation not on record | 3 |
| JBSlocation not on record | 3 |
| Wellington, NZ | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Dehra Dun, IN | 2 |
| San Diego, US | 2 |
| Chapel Hill, US | 2 |
| Provincia di Livornolocation not on record | 2 |
| Görlitz, DE | 2 |
| Pamplona, ES | 2 |
| Santa Barbara, US | 2 |
| Rotorua, NZ | 2 |
| Dresden, DE | 2 |
| Henry Brockhouse Collectionlocation not on record | 2 |
| Tsukuba, JP | 1 |
| Palmerston North, NZ | 1 |
| University of Johannesburglocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Saint Louis, US | 1 |
| Stockholm, SE | 1 |
| Bronx, US | 1 |
| WTUlocation not on record | 1 |
| Uppsala, SE | 1 |
| Boise, US | 1 |
| Podgorica, ME | 1 |
| Porto Alegre, BR | 1 |
| Helsinki, FI | 1 |
| San Luis Obispo, US | 1 |
| US | 1 |
| NSW Office of Environment and Heritagelocation not on record | 1 |
| Angwin, US | 1 |
| University of Stellenboschlocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| Göteborg, SE | 1 |
| Minia, EG | 1 |
| Bern, CH | 1 |
| Flagstaff, US | 1 |
| Edinburgh, GB | 1 |
| Chicago, US | 1 |
111 institutions · 2 077 of 2 172 vouchered records shown · 95 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA2 detections
Where the DNA of Trifolium tomentosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found2
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 2 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 14.5–14.5
Seasonal swing summer↔winter5.00 °C
Max temp (day)15.8 °C
Min temp (night)13.1 °C
Precipitation135 mm/mo
Air humidity59.4 %
Vapour deficit667 Pa
Cloud cover10.8 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.