Trifolium suffocatum
speciesAt a glance
Occurrence records5 577
Data sources12
Biological traits52
DNA specimens9
eDNA detections6
Sources12 archives
Databases and archives Trifolium suffocatum's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 577 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics9 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources52 traits
Chemical compositionLOTUS3 compounds
Occurrence & distributionGBIF5 577 records
Environmental DNA1 datasets · 3 countries6 detections
DNA & barcodingBOLD · NCBI9 specimens
Genome at a glanceCCDB · GoaT2n = 16
01Narrative
Trifolium suffocatum, the suffocated clover, is a species of annual herb in the family Fabaceae. They have a self-supporting growth form and compound, broad leaves. Individuals can grow to 4.2 cm.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology22
Fruit length3 mm
Leaf length5.5 mm
Leaf length max55 mm
Leaf length min3 mm
Leaf size32 mm²
Leaf width4 mm
Leaf width max6 mm
Leaf width min2 mm
Petiole length5.5 cm
Plant height0.06 m
⚠ sources differ — GIFT: 0.06 m · AusTraits: 0.15 m · LEDA: 0.02 m · TRY: 0.03 m
Plant height max0.5 m
Plant height min0.02 m
Seed length0.8 mm
Seed mass0.21 mg
⚠ sources differ — TRY: 0.21 mg · LEDA: 0.191 mg · GIFT: 0.205 mg
Seed mass max0.237 mg
Seed mass min0.19 mg
Seed volume0.18 mm³
Seed volume max0.18 mm³
Seed volume min0.18 mm³
Seed width1 mm
Seed width max1 mm
Seed width min1 mm
Life cycle & reproduction11
Dispersal typeanimal
Flowering endApr
Flowering startApr
Life formannual
Life spanannual
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 150 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
Growth formherb
Habitat GIFTsand
Leaf compoundnesscompound
Leaf shapeobovate obtriangular
Woodinessnon-woody
Physiology & chemistry3
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Other traits2
Plant support typefree-standing
Seeds per fruit101-1000
03Chemical composition3 compounds
Compounds documented for Trifolium suffocatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Pterocarpan3
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| 9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol | present | LOTUS | |
| Medicarpin | present | LOTUS |
05DNA & barcoding9 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium suffocatum has left across the world's sequence archives.
At a glance
DNA specimens9
Marker genes3
GenBank sequences10
eDNA detections6
Countries4
The DNA barcodea real sequence read deposited for this species
AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACACGTGAATCAGTTTGAACACATAGGGTTGG …
Trifolium suffocatum bio-material MFFGC AZ2021 from Portugal small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL1★ITS5
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Trifolium suffocatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–162n range16median16mode29records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1629×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · iber-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · iber-fl — Estudios cariohistolgicos en el gnero Trifolium. Angulo Carpio, M. D., M. C. de Figueras & A. M. Snchez de Rivera.Bol. Soc. Brot. ser. 253(2): 877-885(1981).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Cromosomas de plantas de la estepa de Aragn, III. Lorenzo Andreu, A.Anales Estac. Exp. Aula Dei2: 195-203(1951).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. IV Gonzlez Bernldez, F., A. M. Snchez de Rivera & M. D. Angulo.Lagascalia3(2): 195-203(1973).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2963
CCDB · mediterranean
CCDB · ipcn-api-dl — Angulo, M. D., M. C. D. Figueras & A. M. S. Rivera. 1981. Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 885–887.
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982. Cytotaxonomic study of Trifolium L. in Bulgaria: I. Fitologija 19: 3–23. (In Bulgarian).
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · ipcn-api-dl — Muñoz Rodriguez, A. F. 1996. Trifolium sect. Paramesus y sect. Trifoliastrum en la Península Ibérica. II. Estudio cariológico. Stud. Bot. Univ. Salamanca 14: 103–128.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · book-ipcn67-71 — PRITCHARD, A.J. 1969. Chromosome numbers in some species of Trifoli Austral. J. Agric. Res. 20: 883-887.
CCDB · book-ipcn75-78 — Fernandes
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn73-74 — CHEN, C.-C., & P.B. GIBSON. 1971. Karyotypes of fifteen Trifolium species in section Amoria. Crop Sci. 11: 441-445.
CCDB · book-ipcn73-74 — GONZALEZ-BERNALDEZ, F., SANCHEZ DE RIVERA, A.M., & M.D. ANGULO. 1973. Estudios cromosomicos en genera Trifolium IV. Lagascalia 3: 195-203.
CCDB · CromoCat 2015 — Angulo, M. D., Figueras, M. C. & Sánchez de Rivera, A. M. (1981). Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 877-885.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.
CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.
CCDB · CromoCat 2015 — González Bernáldez, F., Sánchez de Rivera, A. M. & Angulo, M. D. (1973). Estudios cromosómicos en el género Trifolium. IV Lagascalia 3(2): 195-203.
CCDB · CromoCat 2015 — Lorenzo Andreu, A. (1951). Cromosomas de plantas de la estepa de Aragón, III. Anales Estac. Exp. Aula Dei 2: 195-203.
CCDB · CromoCat 2015 — Petrova, A. & S. Kozuharov. (1982). Cytotaxonomic study of genus Trifolium L. in Bulgaria. I. II. Phytology 19: 3-23; 20: 20-41.
CCDB · CromoCat 2015 — Pritchard, A. J. (1969). Chromosome numbers in some species of Trifolium. Austral. J. Agric. Res. 20: 883-887.
CCDB · CromoCat 2015 — Runemark, H. (2006). Reports (1473-1571). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 408-425
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.992 ↗
08Occurrence & distribution
Record type5 577 records
Wild obs. + sensor5 003
Museum / vouchered553
Other21
Origin
Native850
Introduced123
Range
Area of Occupancy AOO7 964 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy32% within 1 km
≤100 m 778≤1 km 737≤10 km 3 069>10 km 136
4 720 georeferenced · 283 without coordinates
Open the mapobservation + sensor5 003
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 20≤1 km 51≤10 km 93>10 km 12
176 georeferenced · 377 without coordinates
Open the institutions mapphysical evidence553
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions37 of 67 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 83 |
| LDlocation not on record | 75 |
| Badajoz, ES | 36 |
| Museo Entomologico de Leonlocation not on record | 36 |
| Adelaide, AU | 21 |
| South Kensington, GB | 19 |
| BClocation not on record | 19 |
| Berlin, DE | 19 |
| Christchurch, NZ | 18 |
| BDBClocation not on record | 17 |
| Salamanca, ES | 17 |
| MAlocation not on record | 14 |
| Mount Annan, AU | 13 |
| CICYTEXlocation not on record | 9 |
| WTUlocation not on record | 9 |
| MeiseBGlocation not on record | 8 |
| Kensington, AU | 8 |
| UIBlocation not on record | 6 |
| CJBGlocation not on record | 6 |
| Wlocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Sevilla, ES | 5 |
| ISAlocation not on record | 5 |
| València, ES | 5 |
| Canberra, AU | 5 |
| Coimbra, PT | 4 |
| BRNUlocation not on record | 4 |
| Hobart, AU | 4 |
| National Museum Waleslocation not on record | 3 |
| Vitoria, ES | 3 |
| Santa Cruz, US | 3 |
| Wellington, NZ | 3 |
| Moscow, US | 3 |
| Bourges, FR | 3 |
| Corvallis, US | 3 |
| GJOlocation not on record | 2 |
| Cape Town, ZA | 2 |
| San Sebastián, ES | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Rishon Le Zion, IL | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| UChlocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Pretoria, ZA | 1 |
| Minia, EG | 1 |
| Auckland, NZ | 1 |
| Granada, ES | 1 |
| University of Stellenboschlocation not on record | 1 |
| Jaén, ES | 1 |
| Philadelphia, US | 1 |
| Barcelona, ES | 1 |
| Claremont, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Parkville, AU | 1 |
| NMWlocation not on record | 1 |
| Brisbane, AU | 1 |
| BG-NMNHSlocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Uppsala, SE | 1 |
| Kew, GB | 1 |
| Moscow State Universitylocation not on record | 1 |
| Córdoba, ES | 1 |
| Görlitz, DE | 1 |
| Boise, US | 1 |
67 institutions · 537 of 553 vouchered records shown · 14 without an institution code
09Environmental DNA6 detections
Where the DNA of Trifolium suffocatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.1 °C 11.6–15.4
Seasonal swing summer↔winter10.6 °C
Max temp (day)14.6 °C 12.8–20.5
Min temp (night)10.4 °C 10.2–12.5
Precipitation56.3 mm/mo 49.0–70.4
Air humidity62.5 % 57.7–65.6
Moisture balance-28.0 mm/mo
Vapour deficit534 Pa 500–804
Wind speed6.00 m/s
Cloud cover41.2 % 38.6–45.3
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.