Trifolium striatum
speciesAt a glance
Occurrence records55 418
Data sources14
Biological traits67
DNA specimens40
eDNA detections17
Sources14 archives
Databases and archives Trifolium striatum's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility55 418 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics40 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources67 traits
Chemical compositionLOTUS3 compounds
Occurrence & distributionGBIF55 418 records
Environmental DNA1 datasets · 7 countries17 detections
DNA & barcodingBOLD · NCBI40 specimens
Genome at a glanceCCDB · GoaT · NCBI421 Mbp
01Narrative
Trifolium striatum, the knotted clover, soft trefoil, is a flowering plant species in the pea and bean family Fabaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology24
Fruit length2 mm
⚠ sources differ — AusTraits: 2 mm · GIFT: 3 mm
Leaf length12 mm
Leaf length max40 mm
Leaf length min3 mm
Leaf mass4.9 mg
⚠ sources differ — AusTraits: 4.9 mg · LEDA: 15.01 mg
Leaf mass per area47.49 g/m2
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · AusTraits: 104 mm² · LEDA: 324 mm² · GIFT: 293 mm²
Leaf width17 mm
Leaf width max15 mm
Leaf width min1.5 mm
Plant height0.159 m
⚠ sources differ — GIFT: 0.159 m · AusTraits: 0.45 m · LEDA: 0.175 m · TRY: 0.203 m
Plant height generative0.19 m
Plant height max0.4 m
Plant height min0.05 m
Seed length1.88 mm
⚠ sources differ — TRY: 1.88 mm · AusTraits: 1.5 mm
Seed mass1.75 mg
⚠ sources differ — TRY: 1.75 mg · AusTraits: 1.9 mg · LEDA: 1.72 mg · GIFT: 1.88 mg
Seed mass max2.76 mg
Seed mass min0.522 mg
Seed volume1.8 mm³
Seed volume max1.8 mm³
Seed volume min1.8 mm³
Seed width2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction18
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: endozoochor · GIFT: anemochorous
Flower colourpink
Flower width max12 mm
Flower width min10 mm
Flowering endAug
Flowering startMay
Life formannual or biennial
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number45
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
Habitat GIFTforest, meadows, mountains, shrubberies
Leaf compoundnesscompound
Leaf formobovate
Leaf shapeoblong obovate
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)305 mg/g
⚠ sources differ — TRY: 305 mg/g · LEDA: 284 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)23.02 mm²/mg
⚠ sources differ — TRY: 23.02 mm²/mg · LEDA: 20.6 mm²/mg · GIFT: 20.87 mm²/mg
Other traits4
Diaspore typegenerative dispersule
Leaf arrangementalternate
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition3 compounds
Compounds documented for Trifolium striatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Pterocarpan3
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| 9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol | present | LOTUS | |
| Medicarpin | present | LOTUS |
05DNA & barcoding40 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium striatum has left across the world's sequence archives.
At a glance
DNA specimens40
Marker genes8
GenBank sequences10
eDNA detections17
Countries9
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATCGAAGCCTCTTG …
Trifolium striatum voucher PLT.0308 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL1★rbcLa★trnL-F★ITS7★ITS2cp-trnL-introntrnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Trifolium striatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size420 540 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium striatum0.42 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records12–162n range14median14mode59records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1456×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +14
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Estudios cariohistolgicos en el gnero Trifolium. Angulo Carpio, M. D., M. C. de Figueras & A. M. Snchez de Rivera.Bol. Soc. Brot. ser. 253(2): 877-885(1981).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 252: 79-164(1978).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VI Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Lagascalia2(1): 3-13(1972).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VII Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Gent. Ibr.24: 305-324(1972).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2980
CCDB · fl-europaea — Kliphuis, 1962
CCDB · ipcn-api-dl — Angulo, M. D., M. C. D. Figueras & A. M. S. Rivera. 1981. Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 885–887.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Issolah, R. & A. Abdelguerfi. 1999. Chromosome numbers within some spontaneous populations of 10 Trifolium species in Algeria. Caryologia 52: 151–154.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982. Cytotaxonomic study of Trifolium L. in Bulgaria: I. Fitologija 19: 3–23. (In Bulgarian).
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. 1993. Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89–118.
CCDB · book-ipcn72 — ANGULO, M.D., A.M. SANCHEZ DE RIVERA, & F. GONZALEZ-BERNALDEZ. 1972. Estudios cromosomicos en el genera Trifolium. VI. Lagascalia 2: 3-13.
CCDB · book-ipcn72 — KUZMANOV, B.A., & G. STANCEV. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn75-78 — Nielsen 1975
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn75-78 — Fernandes
CCDB · book-ipcn75-78 — Kozuharov et al. 1975
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-ipcn73-74 — KOZUHAROV, S. I. , A. V. PETROVA, & T. MARKOV A. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · book-atlas-flowering-plants — Wulff "1939a
CCDB · kew — Vižintin L, Javornik B, Bohanec B. 2006. Genetic characterization of selected Trifolium species as revealed by nuclear DNA content and ITS rDNA region analysis. Plant Science 170: 859-866.
CCDB · Cave1962 — Kliphuis 1962a
CCDB · Cave1963 — Gudella & Klip. 1963
CCDB · CromoCat 2015 — Angulo, M. D., Figueras, M. C. & Sánchez de Rivera, A. M. (1981). Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 877-885.
CCDB · CromoCat 2015 — Angulo, M. D., Sánchez de Rivera, A. M. & González Bernáldez, F. (1972a). Estudios cromosómicos en el género Trifolium. VI. Lagascalia 2(1): 3-13.
+16 more references
2n 162×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1975b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVII]. Taxon 24(1): 145-146.
2n 121×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — KOZUHAROV, S., A. Petrova & T. MARKOVA. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.
n 71×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.988 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.9% BUSCO
07Deep time~25.3 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin25.3 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type55 418 records
Wild obs. + sensor52 064
Museum / vouchered2 958
Cultivated / captive264
Other132
Origin
Native4 762
Introduced1 687
Range
Area of Occupancy AOO65 060 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy48% within 1 km
≤100 m 9 257≤1 km 13 752≤10 km 24 362>10 km 204
47 575 georeferenced · 4 489 without coordinates
Open the mapobservation + sensor52 064
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 188≤1 km 428≤10 km 623>10 km 38
1 277 georeferenced · 1 681 without coordinates
Open the institutions mapphysical evidence2 958
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 18
18 georeferenced · 246 without coordinates
Open the mapnot free-living264
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions99 of 178 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 286 |
| ESP010location not on record | 169 |
| Museo Entomologico de Leonlocation not on record | 164 |
| BIO-UNIPIlocation not on record | 131 |
| MeiseBGlocation not on record | 121 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 109 |
| Oskarshamn, SE | 77 |
| Christchurch, NZ | 67 |
| South Kensington, GB | 63 |
| SLU Artdatabankenlocation not on record | 54 |
| Moscow State Universitylocation not on record | 53 |
| Canberra, AU | 51 |
| CJBGlocation not on record | 51 |
| València, ES | 49 |
| Mount Annan, AU | 48 |
| Badajoz, ES | 46 |
| BDBClocation not on record | 46 |
| MAlocation not on record | 45 |
| DBF-NHMDlocation not on record | 43 |
| Bern, CH | 34 |
| Brussel, BE | 33 |
| BRNUlocation not on record | 32 |
| Entomological Society of Latvialocation not on record | 29 |
| Wlocation not on record | 27 |
| Görlitz, DE | 26 |
| ISAlocation not on record | 26 |
| Berlin, DE | 25 |
| Corvallis, US | 22 |
| Vitoria, ES | 22 |
| Adelaide, AU | 21 |
| CICYTEXlocation not on record | 21 |
| Hobart, AU | 21 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 19 |
| Salamanca, ES | 18 |
| Barcelona, ES | 17 |
| Córdoba, ES | 16 |
| Zürich, CH | 16 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 15 |
| Zürich, CH | 15 |
| BClocation not on record | 14 |
| Dresden, DE | 13 |
| Wellington, NZ | 13 |
| Mlocation not on record | 12 |
| WTUlocation not on record | 12 |
| Uniwersytet Wrocławskilocation not on record | 10 |
| Kensington, AU | 10 |
| Auckland, NZ | 10 |
| UNINE:NEUlocation not on record | 10 |
| San Sebastián, ES | 10 |
| Uppsala, SE | 9 |
| Odawara, JP | 9 |
| Canadian Department of Agriculturelocation not on record | 9 |
| Vancouver, CA | 8 |
| Madrid, ES | 8 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 8 |
| GJOlocation not on record | 8 |
| Nijmegen, NL | 8 |
| Santa Cruz, US | 8 |
| Santiago de Compostela, ES | 7 |
| Riverside, US | 7 |
| BFLlocation not on record | 7 |
| Universität Basel, Herbariumlocation not on record | 7 |
| CJBNlocation not on record | 7 |
| Museo Achille Folettolocation not on record | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Olocation not on record | 6 |
| Paris, FR | 6 |
| NSW Office of Environment and Heritagelocation not on record | 6 |
| Bourges, FR | 6 |
| Brisbane, AU | 6 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| San Luis Obispo, US | 6 |
| Sagamihara, JP | 6 |
| Helsinki, FI | 5 |
| AZE015location not on record | 5 |
| CASlocation not on record | 5 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| Davis, US | 5 |
| Pamplona, ES | 4 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 4 |
| Sevilla, ES | 4 |
| Logan, US | 4 |
| Salvador, BR | 4 |
| Little Rock, US | 4 |
| LfUlocation not on record | 4 |
| John May Museum of Natural Historylocation not on record | 4 |
| PRClocation not on record | 4 |
| Armidale, AU | 4 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 4 |
| ASUlocation not on record | 3 |
| Kew, GB | 3 |
| Palmerston North, NZ | 3 |
| Moscow, US | 3 |
| Pullman, US | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| BSBIlocation not on record | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| Porrentruy, CH | 3 |
| Sant Julià de Lòria, AD | 2 |
| Bangkok, TH | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| SZUlocation not on record | 2 |
| Columbia, US | 2 |
| Chapel Hill, US | 2 |
| Xiamen, CN | 2 |
| Parkville, AU | 2 |
| Granada, ES | 2 |
| Fribourg, CH | 2 |
| Lausanne, CH | 2 |
| UGentlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Clemson, US | 2 |
| Boise, US | 2 |
| GZUlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Stockholm, SE | 2 |
| Philadelphia, US | 2 |
| Universität Erlangen-Nürnberglocation not on record | 2 |
| Alicante, ES | 2 |
| Bronx, US | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 2 |
| Victoria, CA | 2 |
| Claremont, US | 2 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Boumlocation not on record | 1 |
| Madison, US | 1 |
| Toronto, CA | 1 |
| BG-NMNHSlocation not on record | 1 |
| Edmonton, CA | 1 |
| Denver, US | 1 |
| Palmerston, AU | 1 |
| La Trobe Universitylocation not on record | 1 |
| Trondheim, NO | 1 |
| CIBIOlocation not on record | 1 |
| Saint Louis, US | 1 |
| Beijing, CN | 1 |
| Tuscaloosa, US | 1 |
| San Diego, US | 1 |
| Dekalb, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Fulda, DE | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| Fort Bragg, US | 1 |
| PrivatHerblocation not on record | 1 |
| Edinburgh, GB | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Frankfurt am Main | 1 |
| Minia, EG | 1 |
| Davenport, US | 1 |
| Durham, US | 1 |
| Fayetteville, US | 1 |
| University of Stellenboschlocation not on record | 1 |
| Provo, US | 1 |
| Cheney, US | 1 |
| Banyoles, ES | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Sion, CH | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Flagstaff, US | 1 |
| Brookings, US | 1 |
| ER Hellerlocation not on record | 1 |
| Henderson, US | 1 |
| Pamplona, ES | 1 |
| Porvoo, FI | 1 |
| POL003location not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Tilburg, NL | 1 |
| JBSlocation not on record | 1 |
| Gijón, ES | 1 |
| Chongqing Museumlocation not on record | 1 |
| GAlocation not on record | 1 |
| Salzburg, AT | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
178 institutions · 2 619 of 2 958 vouchered records shown · 336 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Trifolium striatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map7 countries0
sea cliff
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 11.3–18.5
Seasonal swing summer↔winter15.1 °C
Max temp (day)17.5 °C 13.0–22.6
Min temp (night)10.4 °C 8.50–13.3
Precipitation66.4 mm/mo 42.8–74.4
Air humidity59.9 % 57.7–64.6
Moisture balance-38.1 mm/mo
Vapour deficit622 Pa 501–887
Wind speed3.60 m/s
Cloud cover41.2 % 35.0–51.8
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.