Trifolium stellatum
speciesAt a glance
Occurrence records25 252
Data sources12
Biological traits40
DNA specimens4
eDNA detections2
Sources12 archives
Databases and archives Trifolium stellatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility25 252 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics4 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources40 traits
Chemical compositionLOTUS · NPASS10 compounds
Occurrence & distributionGBIF25 252 records
Environmental DNA1 datasets · 0 countries2 detections
DNA & barcodingBOLD · NCBI4 specimens
Genome at a glanceCCDB2n = 14
01Narrative
Le Trèfle étoilé est une espèce de plantes à fleurs du genre Trifolium et de la famille des Fabacées. C'est une petite plante herbacée méditerranéenne basse. Elle doit son nom à la forme de son calice qui, lors de la fructification, devient rouge et se déploie en une petite étoile à cinq branches.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVPAusTraits
Size & morphology13
Fruit length3 mm
Inflorescence length max4.5 cm
Inflorescence length min2.2 cm
Leaf length10 mm
Leaf length max20 mm
Leaf width max15 mm
Plant height0.4 m
⚠ sources differ — AusTraits: 0.4 m · TRY: 0.05 m
Plant height max0.4 m
Plant height min0.05 m
Seed length2 mm
Seed mass2.83 mg
⚠ sources differ — TRY: 2.83 mg · LEDA: 3.4 mg · GIFT: 3.14 mg
Seed mass max3.52 mg
Seed mass min1.6 mg
Life cycle & reproduction8
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colourpink
Flowering endApr
Flowering startApr
Life formannual
Life spanannual
Lifespan years1 years
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit typelegume
Growth formherb
Leaf compoundnesscompound
Leaf formobovate
Leaf shapeobcordate
Mycorrhiza typenon-ectomycorrhizal
Woodinessnon-woody
Physiology & chemistry3
Leaf n19.9 mg/g
Leaf p1 mg/g
Photosynthetic pathwayC3
Other traits2
Leaf arrangementalternate
Shoot orientationascending
03Chemical composition10 compounds
Compounds documented for Trifolium stellatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids3
Pterocarpan3
Isoquinoline alkaloids $ Protoberberine alkaloids1
Aporphine alkaloids $ Isoquinoline alkaloids1
Isoflavanones1
Documented compounds10 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Berbamine | present | NPASS | |
| (+)-Magnoflorine | present | NPASS | |
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| (1S,14R)-20,21,25-trimethoxy-15,30-dimethyl-8,23-dioxa-15,30-diazaheptacyclo[22.6.2.29,12.13,7.114,18.027,31.022,33]hexatriaconta-3(36),4,6,9(35),10,12(34),18,20,22(33),24,26,31-dodecaen-6-ol | present | NPASS | |
| 9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol | present | LOTUS | |
| Arvensan | present | LOTUS | |
| Medicarpin | present | LOTUS | |
| Oxyacanthine | present | NPASS | |
| Palmatine | present | NPASS | |
| POIRVLZGTSWEMG-LLVKDONJSA-N | present | NPASS |
05DNA & barcoding4 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium stellatum has left across the world's sequence archives.
At a glance
DNA specimens4
Marker genes3
GenBank sequences9
eDNA detections2
Countries2
The DNA barcodea real sequence read deposited for this species
ATCGAAGCCTCTTGCCAATTTCCTAATGATAGGTATTGTGCAGGGTGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTTGGTTGA …
Trifolium stellatum internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★ITS9
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Trifolium stellatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidydiploid inferred
Chromosome records14–142n range14median14mode38records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1438×CCDB · ita-fl · CCDB · iber-fl · CCDB · nw-europe-fl +7
CCDB · ita-fl — LARSEN K. - 1956. Chromosome studies in some Mediterranean and South European flowering plants.. Bot. Not. , 109(3): 293-307.
CCDB · ita-fl — DE LEONARDIS W., PAVONE P., TERRASI M.C., ZIZZA A. - 1983 (1981). Numeri cromosomici per la flora italiana:814-830.. Inform. Bot. Ital. , 13(2-3): 158-167.
CCDB · iber-fl — Estudios cariohistolgicos en el gnero Trifolium. Angulo Carpio, M. D., M. C. de Figueras & A. M. Snchez de Rivera.Bol. Soc. Brot. ser. 253(2): 877-885(1981).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VII Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Gent. Ibr.24: 305-324(1972).
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2976
CCDB · fl-europaea — Larsen, 195
CCDB · mediterranean
CCDB · ipcn-api-dl — Angulo, M. D., M. C. D. Figueras & A. M. S. Rivera. 1981. Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 885–887.
CCDB · ipcn-api-dl — De Leonardis, W., P. Pavone, M. C. Terrasi & A. Zizza. 1981. Numeri cromosomici per la Flora Italiana: 814-830. Inform. Bot. Ital. 13: 158–167.
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. 1993. Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89–118.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · book-ipcn67-71 — PRITCHARD, A.J. 1969. Chromosome numbers in some species of Trifoli Austral. J. Agric. Res. 20: 883-887.
CCDB · book-ipcn67-71 — ANGULO, M.D., A.M. SANCHEZ DE RIVERA, & F. GONZALEZ-BERNALDEZ. 1971. Estudios cromosomicos en el genera Trifolium.-V Bal. Soc. Brat. 45 (ser. 2): 253-268.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn75-78 — Nielsen 197 5
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn75-78 — Fernandes
CCDB · Cave1956 — Larsen a
CCDB · CromoCat 2015 — Angulo, M. D., Figueras, M. C. & Sánchez de Rivera, A. M. (1981). Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 877-885.
CCDB · CromoCat 2015 — Angulo, M. D., Sánchez de Rivera, A. M. & González Bernáldez, F. (1971). Estudios cromosómicos en el género Trifolium. V. Bol. Soc. Brot. 45: 253-267.
CCDB · CromoCat 2015 — Angulo, M. D., Sánchez de Rivera, A. M. & González Bernáldez, F. (1972b). Estudios cromosómicos en el género Trifolium. VII. Genét. Ibér. 24: 305-324.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.
CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.
CCDB · CromoCat 2015 — Larsen, K. (1956a). Chromosome studies in some Mediterranean and south European flowering plants. Bot. Not. 109(3): 293-307.
CCDB · CromoCat 2015 — Leonardis, W., de Pavone, P., Terrasi, M. C. & Zizza, A. (1981). Numeri cromosomici per la flora italiana: 814-830. Inf. Bot. Ital. 13: 158-167.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Muñoz Rodríguez, A. F. (1993a). Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89-118.
CCDB · CromoCat 2015 — Nielsen, I. (1975). Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180-183.
CCDB · CromoCat 2015 — Pritchard, A. J. (1969). Chromosome numbers in some species of Trifolium. Austral. J. Agric. Res. 20: 883-887.
CCDB · CromoCat 2015 — Runemark, H. (2006). Reports (1473-1571). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 408-425
CCDB · CromoCat 2015 — Zohary, M. (1971). A revision of the species of Trifolium sect. Trifolium (Leguminosae). I. Introduction. Candollea 26: 297-308.
n 74×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Humphries, C. J., Murray, B. G., Bocquet, G. & Vasudevan, K. N. (1978). Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131(4): 391-404.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.984 ↗
08Occurrence & distribution
Record type25 252 records
Wild obs. + sensor22 631
Museum / vouchered1 936
Cultivated / captive162
Other523
Origin
Native451
Introduced54
Range
Area of Occupancy AOO46 560 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy58% within 1 km
≤100 m 6 953≤1 km 2 283≤10 km 6 543>10 km 245
16 024 georeferenced · 6 607 without coordinates
Open the mapobservation + sensor22 631
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy58% within 1 km
≤100 m 42≤1 km 259≤10 km 216>10 km 6
523 georeferenced · 1 413 without coordinates
Open the institutions mapphysical evidence1 936
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 30>10 km 5
35 georeferenced · 127 without coordinates
Open the mapnot free-living162
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions42 of 79 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 367 |
| Berlin, DE | 282 |
| LDlocation not on record | 179 |
| MAlocation not on record | 87 |
| Badajoz, ES | 76 |
| CICYTEXlocation not on record | 75 |
| València, ES | 61 |
| Kew, GB | 55 |
| ESP010location not on record | 47 |
| Museo Entomologico de Leonlocation not on record | 46 |
| College of the Atlantic, Museumlocation not on record | 42 |
| Córdoba, ES | 41 |
| BDBClocation not on record | 39 |
| ISAlocation not on record | 36 |
| Wlocation not on record | 31 |
| BClocation not on record | 31 |
| Granada, ES | 30 |
| Adelaide, AU | 30 |
| UIBlocation not on record | 26 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 24 |
| Madrid, ES | 20 |
| Phyletisches Museum Jenalocation not on record | 19 |
| South Kensington, GB | 17 |
| Barcelona, ES | 17 |
| Alicante, ES | 14 |
| Salamanca, ES | 13 |
| Frankfurt am Main | 11 |
| Adam Mickiewicz University in Poznańlocation not on record | 11 |
| Sevilla, ES | 10 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 9 |
| Rishon Le Zion, IL | 9 |
| Hobart, AU | 8 |
| Jaén, ES | 7 |
| Hunan Geological Museumlocation not on record | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| GJOlocation not on record | 6 |
| BRNUlocation not on record | 6 |
| Vitoria, ES | 6 |
| Canberra, AU | 5 |
| San Sebastián, ES | 5 |
| CJBGlocation not on record | 4 |
| Stockholm, SE | 4 |
| JBSlocation not on record | 4 |
| Karlsruhe, DE | 4 |
| Oskarshamn, SE | 4 |
| Paris, FR | 3 |
| Moscow State Universitylocation not on record | 3 |
| QVMAGlocation not on record | 3 |
| Dresden, DE | 3 |
| Monastir, TN | 3 |
| Bourges, FR | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| GZUlocation not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Henry Brockhouse Collectionlocation not on record | 2 |
| Bern, CH | 2 |
| PRT004location not on record | 2 |
| Mount Annan, AU | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Santiago de Compostela, ES | 2 |
| Wellington, NZ | 1 |
| Provincia di Livornolocation not on record | 1 |
| PRClocation not on record | 1 |
| Kensington, AU | 1 |
| Bratislava, SK | 1 |
| Saint Louis, US | 1 |
| Museo Achille Folettolocation not on record | 1 |
| San Diego, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Brisbane, AU | 1 |
| San Francisco, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Minia, EG | 1 |
| EEZA-CSIClocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Uppsala, SE | 1 |
| Görlitz, DE | 1 |
79 institutions · 1 887 of 1 936 vouchered records shown · 48 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA2 detections
Where the DNA of Trifolium stellatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found2
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 2 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.