Trifolium semipilosum

Fresen. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records619

Data sources13

Biological traits12

DNA specimens6

eDNA detections4

Sources13 archives

Databases and archives Trifolium semipilosum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility619 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF619 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT1.7 Gbp

01Narrative

Trifolium semipilosum, the Kenya clover or Kenya white clover, is a species of flowering plant in the family Fabaceae. It is native to Yemen, Eritrea, Ethiopia, Kenya, Uganda, Tanzania, Malawi and Zimbabwe, and has been introduced to Saint Helena. It is a close wild relative of the important forage crop Trifolium repens (white clover).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.984 mg

⚠ sources differ — TRY: 0.984 mg · GIFT: 0.895 mg

Seed mass max1.22 mg

Seed mass min0.7 mg

Life cycle & reproduction1

Life formperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition5 compounds

Compounds documented for Trifolium semipilosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Pterocarpan3

Carotenoids (C40, β-ε)1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-3-Hydroxy-9-methoxypterocarpan	present	LOTUS
9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol	present	LOTUS
all-trans-alpha-Carotene	present	LOTUS
hydrogen cyanide	present	LOTUS
Medicarpin	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium semipilosum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF154598.1 ↗209 bp

ACGT

ATCGAAGCCTCTTGACAATTTCCTTTTGATAGGTATTGTGCAGGGGGAATGTTGGCCTCCCGTGAGCTCCATCGTCTCATGGTTGGTTGA …

Trifolium semipilosum internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS8

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Trifolium semipilosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 691 940 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Trifolium semipilosum1.69 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Badr, A. 1995. Electrophoretic studies of seed proteins in relation to chromosomal criteria and the relationships of some taxa of Trifolium. Taxon 44: 183–191.

CCDB · kew — Vižintin L, Javornik B, Bohanec B. 2006. Genetic characterization of selected Trifolium species as revealed by nuclear DNA content and ITS rDNA region analysis. Plant Science 170: 859-866.

CCDB · Cave1962 — Pritchard 1962b

n 81×CCDB · Cave1963

CCDB · Cave1963 — Britten 1963b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.992 ↗

08Occurrence & distribution

Record type619 records

Wild obs. + sensor22

Museum / vouchered53

Cultivated / captive132

Other412

Range

Area of Occupancy AOO896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 1≤10 km 1>10 km 3

5 georeferenced · 17 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence53

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 7>10 km 1

8 georeferenced · 124 without coordinates

Open the mapnot free-living132

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	16
MeiseBGlocation not on record	5
National Museums of Kenyalocation not on record	3
Saint Louis, US	2
MAlocation not on record	1
CJBGlocation not on record	1
Berlin, DE	1
Edinburgh, GB	1
Wlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
University of Stellenboschlocation not on record	1
Frankfurt am Main	1

12 institutions · 34 of 53 vouchered records shown · 19 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Trifolium semipilosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)