Trifolium scabrum
speciesAt a glance
Occurrence records45 080
Data sources13
Biological traits64
DNA specimens18
eDNA detections9
Sources13 archives
Databases and archives Trifolium scabrum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility45 080 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics18 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources64 traits
Chemical compositionLOTUS3 compounds
Occurrence & distributionGBIF45 080 records
Environmental DNA1 datasets · 2 countries9 detections
DNA & barcodingBOLD · NCBI18 specimens
Genome at a glanceCCDB · GoaT499 Mbp
01Narrative
Le trèfle scabre est une espèce de plantes à fleurs de la famille des Fabacées. C'est une plante annuelle, pubescente, flexueuse trouvée autour de la Méditerranée.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology24
Fruit length2 mm
Inflorescence length max1.8 cm
Inflorescence length min0.7 cm
Leaf length7.5 mm
Leaf length max20 mm
Leaf length min5 mm
Leaf size32 mm²
Leaf width4.5 mm
Leaf width max10 mm
Leaf width min3 mm
Plant height0.158 m
⚠ sources differ — GIFT: 0.158 m · AusTraits: 0.16 m · LEDA: 0.158 m · TRY: 0.092 m
Plant height generative0.115 m
Plant height max0.3 m
Plant height min0.05 m
Seed length1.5 mm
Seed mass0.62 mg
⚠ sources differ — TRY: 0.62 mg · LEDA: 0.562 mg · GIFT: 0.61 mg
Seed mass max0.8 mg
Seed mass min0.275 mg
Seed volume0.55 mm³
Seed volume max0.55 mm³
Seed volume min0.55 mm³
Seed width1.25 mm
Seed width max1.25 mm
Seed width min1.25 mm
Life cycle & reproduction17
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
Flower colourwhite
Flower length max5 mm
Flower length min4 mm
Flowering endAug
Flowering startMay
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 700 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
Habitat GIFTdry gravelly slopes of the submontane and low-mountain zones, on gravel and sand, as a component of ephermeral vegetation
Leaf compoundnesscompound
Leaf formobovate
Leaf shapeobovate obtriangular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)301 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)19.16 mm²/mg
Other traits3
Diaspore typeinfructescence
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition3 compounds
Compounds documented for Trifolium scabrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Pterocarpan3
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| 9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol | present | LOTUS | |
| Medicarpin | present | LOTUS |
05DNA & barcoding18 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium scabrum has left across the world's sequence archives.
At a glance
DNA specimens18
Marker genes6
GenBank sequences10
eDNA detections9
Countries5
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCACTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATCGAAGCCTCTTG …
Trifolium scabrum voucher PLT.0588 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★trnL-F★ITS10★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Trifolium scabrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size498 780 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium scabrum0.50 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 10 n = 5
Ploidydiploid inferred
Chromosome records10–162n range10median10mode71records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1063×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · brit-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — LOON J.C. - 1980. Chromosome number reports LXIX.. Taxon , 29(5-6): 703-730.
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · iber-fl — Estudios cariohistolgicos en el gnero Trifolium. Angulo Carpio, M. D., M. C. de Figueras & A. M. Snchez de Rivera.Bol. Soc. Brot. ser. 253(2): 877-885(1981).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. III Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Bol. Soc. Brot. ser. 244: 13-26(1970).
CCDB · iber-fl — Estudios cromosmicos en el gnero Trifolium. VII Angulo Carpio, M. D., A. M. Snchez de Rivera & F. Gonzlez Bernldez.Gent. Ibr.24: 305-324(1972).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2982
CCDB · fl-europaea — Gadella &
CCDB · mediterranean
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. 1993. Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89–118.
CCDB · ipcn-api-dl — Angulo, M. D., M. C. D. Figueras & A. M. S. Rivera. 1981. Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 885–887.
CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — ANGULO, M. D. & M. C. Figueras. 1979. Numeros cromosomicos y sacos polinicos en especies del genero Trifolium. Genét. Ibér. 30–31: 129–160.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982a. Cytotaxonomic study of Trifolium L.: Bulgaria II. Fitologija 20: 20–40. (In Bulgarian).
CCDB · book-ipcn72 — KOZUHAROV, S.I., B.A. KUZMANOV, T. MARKOVA. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · book-ipcn72 — KUZMANOV, B.A., & G. STANCEV. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J . & E. KLIPHUIS. 1968. In IOPB chromosome number reports XVI. Taxon 17: 199-204.
CCDB · book-ipcn67-71 — ANGULO, M.D., A.M. SANCHEZ DE RIVERA, & F. GONZALEZ BERNALDEZ. 1970. Estudios cromosomicos en el genero Trifolium. III. Bol. Soc. Bort. 44Cser 2): 13-26.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn67-71 — VAN LOON, J.C., T.W.J. GADELLA, & E. KLIPHUIS. 1971. Cytological studies in some flowering plants from Southern France. Acta Bot. Neerl. 20: 157-166.
CCDB · book-ipcn75-78 — Fernandes
CCDB · book-ipcn75-78 — Nielsen 1975
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-ipcn73-74 — KOZUHAROV, S. I. , A. V. PETROVA, & T. MARKOV A. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · Cave1962 — Kliphuis 1962a
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Angulo, M. D., Figueras, M. C. & Sánchez de Rivera, A. M. (1981). Estudios cariohistológicos en el género Trifolium. Bol. Soc. Brot. 53: 877-885.
CCDB · CromoCat 2015 — Angulo, M. D. & Figueras, M. C. (1979). Números cromosómicos y sacos polínicos en especies del género Trifolium. Genét. Ibér. 31: 129-160.
+21 more references
2n 167×CCDB · iber-fl · CCDB · book-ipcn73-74 · CCDB · book-atlas-flowering-plants +1
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · book-ipcn73-74 — VAN LOON, J. 1974. A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.
CCDB · book-atlas-flowering-plants — Fo
CCDB · CromoCat 2015 — Karpechenko, G. D. (1925). Karyologische studien über dir gattung Trifolium L. Bull. Appl. Bot., Genet. & Plant Breeding 14: 271-279.
CCDB · CromoCat 2015 — Loon van, J. C. (1974). A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.
CCDB · CromoCat 2015 — Mesquita Rodrigues, J. E. (1953). Contribuiçao para o conhecimento cariológico das halófilas e psamófitas litorais. Diss. Univ. Coimbra 1-210
CCDB · CromoCat 2015 — Zohary, M. (1971). A revision of the species of Trifolium sect. Trifolium (Leguminosae). I. Introduction. Candollea 26: 297-308.
2n 121×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Issolah, R. & Abdelguerfi, A. (1999). Chromosome numbers within some spontaneous populations of 10 Trifolium species in Algeria Caryologia 52: 151–154
n 54×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Humphries, C. J., Murray, B. G., Bocquet, G. & Vasudevan, K. N. (1978). Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131(4): 391-404.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.992 ↗
08Occurrence & distribution
Record type45 080 records
Wild obs. + sensor41 289
Museum / vouchered3 089
Cultivated / captive156
Other546
Origin
Native3 692
Introduced556
Range
Area of Occupancy AOO58 292 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy38% within 1 km
≤100 m 4 513≤1 km 8 838≤10 km 21 262>10 km 324
34 937 georeferenced · 6 352 without coordinates
Open the mapobservation + sensor41 289
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 193≤1 km 427≤10 km 623>10 km 17
1 260 georeferenced · 1 829 without coordinates
Open the institutions mapphysical evidence3 089
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 39>10 km 12
51 georeferenced · 105 without coordinates
Open the mapnot free-living156
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions65 of 121 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 384 |
| Berlin, DE | 326 |
| LDlocation not on record | 259 |
| Adelaide, AU | 127 |
| MAlocation not on record | 106 |
| València, ES | 105 |
| Brussel, BE | 77 |
| CJBGlocation not on record | 77 |
| Museo Entomologico de Leonlocation not on record | 75 |
| Vitoria, ES | 72 |
| Bern, CH | 68 |
| MeiseBGlocation not on record | 66 |
| Badajoz, ES | 62 |
| BClocation not on record | 57 |
| Entomological Society of Latvialocation not on record | 55 |
| Moscow State Universitylocation not on record | 52 |
| BDBClocation not on record | 48 |
| South Kensington, GB | 43 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 38 |
| CICYTEXlocation not on record | 38 |
| Granada, ES | 38 |
| Wlocation not on record | 36 |
| San Sebastián, ES | 34 |
| Córdoba, ES | 34 |
| BRNUlocation not on record | 34 |
| Phyletisches Museum Jenalocation not on record | 32 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 31 |
| UIBlocation not on record | 29 |
| Barcelona, ES | 27 |
| ISAlocation not on record | 27 |
| College of the Atlantic, Museumlocation not on record | 22 |
| Canberra, AU | 20 |
| Madrid, ES | 19 |
| Pamplona, ES | 18 |
| Salamanca, ES | 17 |
| Sevilla, ES | 16 |
| Zürich, CH | 15 |
| Zürich, CH | 15 |
| Kensington, AU | 14 |
| Christchurch, NZ | 12 |
| Alicante, ES | 12 |
| Pamplona, ES | 11 |
| Frankfurt am Main | 11 |
| Auckland, NZ | 11 |
| Universität Basel, Herbariumlocation not on record | 11 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 11 |
| Paris, FR | 11 |
| Mount Annan, AU | 11 |
| UNINE:NEUlocation not on record | 10 |
| GJOlocation not on record | 9 |
| ESP010location not on record | 8 |
| Lausanne, CH | 8 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 7 |
| BSBIlocation not on record | 6 |
| GBR016location not on record | 6 |
| Edinburgh, GB | 6 |
| Provincia di Livornolocation not on record | 5 |
| Bourges, FR | 5 |
| Wellington, NZ | 5 |
| Porrentruy, CH | 5 |
| Jaén, ES | 5 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| Kew, GB | 4 |
| Rishon Le Zion, IL | 4 |
| Hobart, AU | 4 |
| BG-NMNHSlocation not on record | 4 |
| JBSlocation not on record | 4 |
| Oskarshamn, SE | 4 |
| Riverside, US | 3 |
| Coimbra, PT | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 3 |
| Santiago de Compostela, ES | 3 |
| UGentlocation not on record | 3 |
| Santa Cruz, US | 3 |
| POL003location not on record | 2 |
| EEZA-CSIClocation not on record | 2 |
| Durham, US | 2 |
| GZUlocation not on record | 2 |
| Görlitz, DE | 2 |
| Sant Julià de Lòria, AD | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Philadelphia, US | 2 |
| National Museum Waleslocation not on record | 2 |
| Brisbane, AU | 2 |
| Claremont, US | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Pullman, US | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Armidale, AU | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Bratislava, SK | 1 |
| CJBNlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Namur, BE | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| AZE015location not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Uppsala, SE | 1 |
| Gijón, ES | 1 |
| Helsinki, FI | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Podgorica, ME | 1 |
| Santa Barbara, US | 1 |
| Palmerston North, NZ | 1 |
| San Diego, US | 1 |
| Smithfield, AU | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Saint Louis, US | 1 |
| PRClocation not on record | 1 |
| Rotorua, NZ | 1 |
| Sion, CH | 1 |
| Parkville, AU | 1 |
| CIBIOlocation not on record | 1 |
| Boumlocation not on record | 1 |
| Xiamen, CN | 1 |
| Banyoles, ES | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
121 institutions · 2 907 of 3 089 vouchered records shown · 180 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Trifolium scabrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map2 countries0
sea cliff
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 13.2–17.6
Seasonal swing summer↔winter11.2 °C
Max temp (day)17.9 °C 15.2–22.7
Min temp (night)10.8 °C 10.4–13.6
Precipitation70.4 mm/mo 47.3–94.0
Air humidity63.5 % 55.8–65.0
Moisture balance-28.0 mm/mo
Vapour deficit657 Pa 534–930
Wind speed3.30 m/s
Cloud cover41.2 % 38.6–51.2
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.