Trifolium rubens
speciesAt a glance
Occurrence records32 307
Data sources11
Biological traits36
DNA specimens4
eDNA detections62
Sources11 archives
Databases and archives Trifolium rubens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility32 307 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics4 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources36 traits
Chemical compositionLOTUS7 compounds
Occurrence & distributionGBIF32 307 records
Environmental DNA2 datasets · 1 countries62 detections
DNA & barcodingBOLD · NCBI4 specimens
Genome at a glanceCCDB2n = 16
01Narrative
Le trèfle rougeâtre, encore appelé trèfle rouge ou queue de renard, est une espèce de plantes à fleurs de la famille des Fabacées. C'est une plante herbacée rhizomateuse vivace trouvée en Europe centrale et du sud, jusqu'en Ukraine.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology10
Leaf mass57.58 mg
Leaf size929 mm²
Plant height0.425 m
⚠ sources differ — GIFT: 0.425 m · LEDA: 0.425 m · TRY: 0.312 m
Plant height generative0.45 m
Plant height max0.8 m
Plant height min0.2 m
Seed length1.95 mm
Seed mass2.08 mg
Seed mass max2.08 mg
Seed mass min2.01 mg
Life cycle & reproduction12
Deciduousnessdeciduous
Dispersal typeanimal
Flowering endJul
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years6 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Seed number255
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment6
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest edges, meadows, shrubberies
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio20.82 g/g
Leaf c465 mg/g
Leaf dry-matter content (LDMC)279 mg/g
Leaf n22.39 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)16.64 mm²/mg
Other traits1
Diaspore typegerminule
03Chemical composition7 compounds
Compounds documented for Trifolium rubens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Isoflavones4
Pterocarpan3
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| 9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol | present | LOTUS | |
| Biochanin A | present | LOTUS | |
| Daidzein | present | LOTUS | |
| Formononetin | present | LOTUS | |
| Genistein | present | LOTUS | |
| Medicarpin | present | LOTUS |
05DNA & barcoding4 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium rubens has left across the world's sequence archives.
At a glance
DNA specimens4
Marker genes3
GenBank sequences10
eDNA detections62
Countries1
The DNA barcodea real sequence read deposited for this species
AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATATCTAACACGTGAATAAGTTTGGACACATAAGGTTGGCTT …
Trifolium rubens bio-material USDA NPGS PI 440748 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL1★ITS6
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Trifolium rubens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–162n range16median16mode20records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1620×CCDB · slov-fl · CCDB · iber-fl · CCDB · poland +6
CCDB · slov-fl — Holub J., Měsíček J. & Javůrková V., 1972: Annotated chromosome counts of Czechoslovak plants (31–60) (Materials for "Flóra ČSSR"– 3). - Folia Geobot. Phytotax. 7/2: 167-202.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · iber-fl — Trifolium sect. Trifolium. II. Estudio cariolgico. Muoz Rodrguez, A. F.Acta Bot. Malacitana18: 89-118(1993).
CCDB · poland — Pogan E., Jankun A., Sawicka Z. et al. 1989. Further studies in chromosome numbers of Polish Angiosperms. Part XXII. Acta Biol. Cracov. Ser. Bot. 31, 1-17.
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982. Cytotaxonomic study of Trifolium L. in Bulgaria: I. Fitologija 19: 3–23. (In Bulgarian).
CCDB · ipcn-api-dl — Turåla-Szybowska, K. 1989. Further studies in chromosome numbers of Polish angiosperms. Part XXII. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & Z. Sawicka. 1990. Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. 1993. Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89–118.
CCDB · ipcn-api-dl — Badr, A. 1995. Electrophoretic studies of seed proteins in relation to chromosomal criteria and the relationships of some taxa of Trifolium. Taxon 44: 183–191.
CCDB · book-ipcn72 — HOLUB, J., J. MESICEK, & v. JAVURKOVA. 1972. Annotated chromo- some counts of Czechoslovak plants (31-60). (Materials for a Flora CSSR-3) Folia Geob. Phyto. (Czech. l 7: 167-202.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn73-74 — NILSSON, Q., & P. LASSEN. 1971. Chromosome numbers of vascular pla from Austria, Mallorca and Yugoslav1a. Bot. Not1ser 124: 270-276. I
CCDB · book-atlas-flowering-plants — Fo
CCDB · CromoCat 2015 — Badr, A. (1995). Electrophoretic studies of seeds proteins in relation to chromososmal criteria and the relationships of some taxa of Trifolium Taxon 44(2): 183-191.
CCDB · CromoCat 2015 — Holub, J., Mesícek, J. & Javürková, V. (1972). Annotated chromosome counts of Czechoslovak plants (31-60). Folia Geobot. Phytotax. (Bohem.) 7: 167-202.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 287-288.
CCDB · CromoCat 2015 — Muñoz Rodríguez, A. F. (1993a). Trifolium sect. Trifolium. II. Estudio cariológico. Acta Bot. Malac. 18: 89-118.
CCDB · CromoCat 2015 — Petrova, A. & S. Kozuharov. (1982). Cytotaxonomic study of genus Trifolium L. in Bulgaria. I. II. Phytology 19: 3-23; 20: 20-41.
CCDB · CromoCat 2015 — Pogan, E., A. Jankun & Z. Sawicka (1990). Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1-17.
CCDB · CromoCat 2015 — Turåla-Szybowska, K. (1989). Further studies in chromosome numbers of Polish angiosperms. Part XXII. Acta Biol. Cracov., Ser. Bot. 31: 1–17
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.988 ↗
08Occurrence & distribution
Record type32 307 records
Wild obs. + sensor30 739
Museum / vouchered1 370
Cultivated / captive22
Other176
Origin
Native16
Introduced36
Range
Area of Occupancy AOO37 484 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy16% within 1 km
≤100 m 3 185≤1 km 885≤10 km 20 262>10 km 372
24 704 georeferenced · 6 035 without coordinates
Open the mapobservation + sensor30 739
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 63≤1 km 150≤10 km 356>10 km 69
638 georeferenced · 732 without coordinates
Open the institutions mapphysical evidence1 370
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy33% within 1 km
≤1 km 2≤10 km 4
6 georeferenced · 16 without coordinates
Open the mapnot free-living22
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions42 of 101 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 200 |
| BIO-UNIPIlocation not on record | 175 |
| BFLlocation not on record | 87 |
| LDlocation not on record | 69 |
| Zürich, CH | 69 |
| KFGBlocation not on record | 63 |
| Zürich, CH | 46 |
| Adam Mickiewicz University in Poznańlocation not on record | 37 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 37 |
| Bern, CH | 33 |
| Museo Entomologico de Leonlocation not on record | 29 |
| BRNUlocation not on record | 29 |
| BDBClocation not on record | 25 |
| No collectionlocation not on record | 24 |
| MeiseBGlocation not on record | 21 |
| València, ES | 18 |
| BClocation not on record | 18 |
| Wlocation not on record | 17 |
| GJOlocation not on record | 16 |
| Mlocation not on record | 14 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| LfUlocation not on record | 11 |
| Oskarshamn, SE | 9 |
| GBR016location not on record | 9 |
| Porrentruy, CH | 9 |
| Bourges, FR | 8 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| CJBGlocation not on record | 7 |
| Provincia di Livornolocation not on record | 7 |
| Moscow State Universitylocation not on record | 7 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| Glarus, CH | 5 |
| San Sebastián, ES | 5 |
| Görlitz, DE | 5 |
| MAlocation not on record | 5 |
| PrivatHerblocation not on record | 5 |
| PRClocation not on record | 4 |
| Salzburg, AT | 4 |
| SLU Artdatabankenlocation not on record | 4 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 4 |
| H-Dunkellocation not on record | 4 |
| Entomological Society of Latvialocation not on record | 3 |
| Frauenfeld, CH | 3 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 3 |
| UGentlocation not on record | 3 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| Winterthur, CH | 3 |
| Barcelona, ES | 3 |
| SVN019location not on record | 3 |
| SZUlocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Salvador, BR | 2 |
| H-Adlerlocation not on record | 2 |
| Pamplona, ES | 2 |
| Alicante, ES | 2 |
| Vitoria, ES | 2 |
| Wellington, NZ | 2 |
| GZUlocation not on record | 2 |
| Berlin, DE | 2 |
| Lausanne, CH | 2 |
| South Kensington, GB | 2 |
| Sion, CH | 2 |
| H-AkrKGlocation not on record | 2 |
| Monastir, TN | 2 |
| Granada, ES | 2 |
| Dresden, DE | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Badajoz, ES | 2 |
| UoB-IBlocation not on record | 1 |
| Beijing, CN | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| H-HarzKurtlocation not on record | 1 |
| Madrid, ES | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Jaén, ES | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| NoColllocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| Pocatello, US | 1 |
| Uppsala, SE | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Saint Louis, US | 1 |
| SVK001location not on record | 1 |
| Salamanca, ES | 1 |
| Adelaide, AU | 1 |
| Macomb, US | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Fribourg, CH | 1 |
| IPE-CSIClocation not on record | 1 |
| Palmerston North, NZ | 1 |
| KMNlocation not on record | 1 |
| Banyoles, ES | 1 |
| ULBF-AGRlocation not on record | 1 |
| Paris, FR | 1 |
| Tilburg, NL | 1 |
101 institutions · 1 267 of 1 370 vouchered records shown · 98 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA62 detections
Where the DNA of Trifolium rubens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found62
Studies independent surveys2
Countries1
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 62 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.0 °C 18.0–18.7
Seasonal swing summer↔winter21.2 °C
Max temp (day)22.4 °C 22.2–23.4
Min temp (night)13.9 °C 13.7–14.0
Precipitation76.4 mm/mo 61.6–85.4
Air humidity59.6 % 58.5–60.5
Moisture balance-42.4 mm/mo -54.0–-39.2
Vapour deficit834 Pa 821–898
Wind speed3.50 m/s 3.50–3.60
Cloud cover31.5 % 31.1–34.4
CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.