Trifolium resupinatum
speciesAt a glance
Occurrence records25 741
Data sources13
Biological traits63
DNA specimens36
eDNA detections18
Sources13 archives
Databases and archives Trifolium resupinatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility25 741 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics36 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources63 traits
Chemical compositionLOTUS · NPASS55 compounds
Occurrence & distributionGBIF25 741 records
Environmental DNA1 datasets · 4 countries18 detections
DNA & barcodingBOLD · NCBI36 specimens
Genome at a glanceCCDB · GoaT508 Mbp
01Narrative
Trifolium resupinatum, le trèfle de Perse ou trèfle renversé, est une espèce de plantes à fleurs du genre Trifolium et de la famille des Fabacées. C'est une plante herbacée prairiale annuelle présente en Europe et en Asie fréquemment utilisée comme fourrage et engrais vert.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology23
Fruit length2 mm
⚠ sources differ — AusTraits: 2 mm · GIFT: 3 mm
Leaf length31.5 mm
Leaf length max33 mm
Leaf length min6 mm
Leaf mass7.7 mg
Leaf size278 mm²
Leaf width11.5 mm
Leaf width max21 mm
Leaf width min3 mm
Plant height0.14 m
⚠ sources differ — GIFT: 0.14 m · AusTraits: 0.3 m · LEDA: 0.14 m · TRY: 0.2 m
Plant height generative0.09 m
Plant height max0.6 m
Plant height min0.1 m
Seed length1.28 mm
⚠ sources differ — TRY: 1.28 mm · AusTraits: 1 mm
Seed mass0.722 mg
⚠ sources differ — TRY: 0.722 mg · LEDA: 0.65 mg · GIFT: 1.15 mg
Seed mass max5.91 mg
Seed mass min0.59 mg
Seed volume1.3 mm³
Seed volume max1.3 mm³
Seed volume min1.3 mm³
Seed width1.3 mm
Seed width max1.3 mm
Seed width min1.3 mm
Life cycle & reproduction16
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flower colourpink
Flowering endApr
Flowering startMar
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number7
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
Habitat GIFTmeadows: wet, oasis, sand
Leaf compoundnesscompound
Leaf formobovate
Leaf shapeobovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)170 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)33.97 mm²/mg
Other traits3
Diaspore typegerminule
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition55 compounds
Compounds documented for Trifolium resupinatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Polyprenylated cyclic polyketides (Hop meroterpenoids)11
Plant xanthones11
Oleanane triterpenoids8
Isoflavones6
Stigmastane steroids4
Documented compounds55 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,13R,15R)-15-[(2E)-3,7-dimethylocta-2,6-dienyl]-6,7-dihydroxy-16,16-dimethyl-1,13-bis(3-methylbut-2-enyl)-3-oxatetracyclo[11.3.1.02,11.04,9]heptadeca-2(11),4,6,8-tetraene-10,12,17-trione | present | NPASS | |
| (1R,13R,15S)-15-[(2E)-3,7-dimethylocta-2,6-dienyl]-6,7-dihydroxy-16,16-dimethyl-1,13-bis(3-methylbut-2-enyl)-3-oxatetracyclo[11.3.1.02,11.04,9]heptadeca-2(11),4,6,8-tetraene-10,12,17-trione | present | NPASS | |
| (1R,2R)-1,2-dihydroxypropane-1,2,3-tricarboxylic acid | present | NPASS | |
| (2R,3R,4R,5S,6S)-6-[[(3S,4R,4aR,6aR,6bS,8aS,9R,12aR,14aR,14bR)-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-9-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-5-[(2R,3S,4R,5R,6S)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (2R,3R,4S,5S,6R)-2-[[(3S,5S,8R,9S,10S,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2R,3R,4S,5S,6S)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aR,9R,12aS,14aR,14bR)-9-hydroxy-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-5-[(2S,3R,4S,5R)-4,5-dihydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5S,6S)-6-[[(3S,4R,4aR,6aR,6bS,8aR,9R,12aS,14aR,14bR)-9-hydroxy-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-5-[(2S,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (3S,4S,4aS,6aR,6bS,8aR,9R,12aR,14aR,14bR)-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-3,9-diol | present | LOTUS | |
| 1,3,7-Trihydroxy-2-(3-methylbut-2-enyl)-xanthone | present | NPASS |
05DNA & barcoding36 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium resupinatum has left across the world's sequence archives.
At a glance
DNA specimens36
Marker genes8
GenBank sequences10
eDNA detections18
Countries7
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATCGAAGCCTCTTG …
Trifolium resupinatum voucher PLT.0302 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★trnL-F★ITS6★ITS1★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Trifolium resupinatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size507 582 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium resupinatum0.51 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records14–322n range16median16mode42records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1639×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iber-fl +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — COLOMBO P., COLOMBO R., MARCEN C., PAVONE P. - 1978. Numeri cromosomici per la flora italiana:517-525.. Inform. Bot. Ital. , 10(3): 406-413.
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · iber-fl — Estudio biosistemtico de Trifolium sect. Vesicastrum en la Pennsula Ibrica. Muoz Rodrguez, A. F.Stud. Bot. Univ. Salamanca11: 259-295(1993).
CCDB · poland — Pogan E., Czapik R. and Jankun A. et al. 1985. Further studies in chromosome numbers of Polish Angiosperms Part XVIII. Acta Biol. Cracov. Ser. Bot. 27, 57-74.
CCDB · mediterranean
CCDB · ipcn-api-dl — Colombo, P., R. Colombo, C. Marceno & P. PAVONE. 1978. Numeri cromosomici per la Flora Italiana. 517-525. Inform. Bot. Ital. 10: 406–413.
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK & A. Jankun. 1985. Further studies in chromosome numbers of Polish angiosperms. Part XVIII. Acta Biol. Cracov., Ser. Bot. 27: 57–74.
CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982. Cytotaxonomic study of Trifolium L. in Bulgaria: I. Fitologija 19: 3–23. (In Bulgarian).
CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.
CCDB · ipcn-api-dl — Muñoz Rodríguez, A. F. 1993. Estudio biosistemático de Trifolium sect. Vesicastrum en la Península Ibérica. Stud. Bot. Univ. Salamanca 11: 259–295.
CCDB · ipcn-api-dl — Badr, A. 1995. Electrophoretic studies of seed proteins in relation to chromosomal criteria and the relationships of some taxa of Trifolium. Taxon 44: 183–191.
CCDB · ipcn-api-dl — Issolah, R. & A. Abdelguerfi. 1999. Chromosome numbers within some spontaneous populations of 10 Trifolium species in Algeria. Caryologia 52: 151–154.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn75-78 — Fernandes & Queiros 1978
CCDB · book-ipcn75-78 — Fernandes
CCDB · book-indian_vol1 — Bleier, H. 1925a, b ; Karpechenko (Fedorov) ; Evans, A.M. 1962; Bir, S.S. & Kumari, S. 1980
CCDB · book-atlas-flowering-plants — Karpechenko 1925
CCDB · kew — Vižintin L, Javornik B, Bohanec B. 2006. Genetic characterization of selected Trifolium species as revealed by nuclear DNA content and ITS rDNA region analysis. Plant Science 170: 859-866.
CCDB · CromoCat 2015 — Almeida, J. L., de. (1957). Trevos autotetraploides I. O caso de Trifolium resupinatum L. ssp. suaveolens (Willd.) Dinsm. Agron. Lusit. 19: 127-144.
CCDB · CromoCat 2015 — Badr, A. (1995). Electrophoretic studies of seeds proteins in relation to chromososmal criteria and the relationships of some taxa of Trifolium Taxon 44(2): 183-191.
CCDB · CromoCat 2015 — Bleier, H. (1925a). Chromosomenstudien bei der gattung Trifolium. Jahrb. Wiss. Bot. 64: 604-636.
CCDB · CromoCat 2015 — Colombo, P., Colombo, R., Marcenò, C. & Pavone, P. (1978). Numeri cromosomici per la flora italiana: 517-525. Inf. Bot. Ital. 10: 406-413.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1971). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae. Bol. Soc. Brot. 45: 177-226.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1975). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Bol. Soc. Brot. 49: 173-196.
CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.
CCDB · CromoCat 2015 — Karpechenko, G. D. (1925). Karyologische studien über dir gattung Trifolium L. Bull. Appl. Bot., Genet. & Plant Breeding 14: 271-279.
CCDB · CromoCat 2015 — Muñoz Rodríguez, A. F. (1993b). Estudio biosistemático de Trifolium sect. Vesicastrum en la Península Ibérica. Stud. Bot. Univ. Salamanca 11: 259-295.
CCDB · CromoCat 2015 — Pogan, E., R. Czapik & A. Jankun. (1985). Further studies in chromosome numbers of Polish Angiosperms. Part XVIII. Acta Biol. Cracov., Ser. Bot. 27: 57-74.
CCDB · CromoCat 2015 — Runemark, H. (2006). Reports (1473-1571). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 408-425
2n 142×CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · book-indian_vol1 — Wipf, L. 1939
CCDB · CromoCat 2015 — Wipf, L. (1939). Chromosome numbers in root nodules and root-tips of certain Leguminosae. Bot. Gaz. 101: 51-67.
2n 321×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Petrova, A. & S. Kozuharov. (1982). Cytotaxonomic study of genus Trifolium L. in Bulgaria. I. II. Phytology 19: 3-23; 20: 20-41.
n 84×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Jahan, B., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in some taxa of Fabaceae mostly native to Pakistan. Ann. Missouri Bot. Gard. 81: 792–799.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · CromoCat 2015 — Jahan, B., Vahidy, A. A. & Ali, S. I. (1994). Chromosome numbers in some taxa Fabaceae mostly native to Pakistan. Ann. Missouri Bot. Gar. 81:792-799
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.992 ↗
08Occurrence & distribution
Record type25 741 records
Wild obs. + sensor22 621
Museum / vouchered2 528
Cultivated / captive130
Other462
Origin
Native6
Introduced374
Range
Area of Occupancy AOO61 944 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy49% within 1 km
≤100 m 6 483≤1 km 1 908≤10 km 8 561>10 km 321
17 273 georeferenced · 5 348 without coordinates
Open the mapobservation + sensor22 621
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy56% within 1 km
≤100 m 179≤1 km 361≤10 km 314>10 km 116
970 georeferenced · 1 558 without coordinates
Open the institutions mapphysical evidence2 528
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 22>10 km 14
36 georeferenced · 94 without coordinates
Open the mapnot free-living130
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions106 of 192 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 281 |
| LDlocation not on record | 148 |
| Berlin, DE | 132 |
| BFLlocation not on record | 111 |
| Helsinki, FI | 78 |
| MAlocation not on record | 69 |
| MeiseBGlocation not on record | 60 |
| Entomological Society of Latvialocation not on record | 58 |
| Museo Entomologico de Leonlocation not on record | 44 |
| Olocation not on record | 41 |
| Auckland, NZ | 37 |
| BClocation not on record | 35 |
| CICYTEXlocation not on record | 35 |
| Kuopio, FI | 33 |
| Badajoz, ES | 32 |
| Mount Annan, AU | 30 |
| Oulu, FI | 28 |
| Görlitz, DE | 28 |
| Salamanca, ES | 26 |
| Christchurch, NZ | 26 |
| BDBClocation not on record | 25 |
| SLU Artdatabankenlocation not on record | 25 |
| València, ES | 24 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 24 |
| Córdoba, ES | 23 |
| BRNUlocation not on record | 21 |
| Wlocation not on record | 21 |
| Hobart, AU | 20 |
| QAUlocation not on record | 19 |
| South Kensington, GB | 19 |
| Adam Mickiewicz University in Poznańlocation not on record | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| College of the Atlantic, Museumlocation not on record | 17 |
| Oskarshamn, SE | 16 |
| Jackson, US | 16 |
| US | 15 |
| Turku, FI | 15 |
| Sevilla, ES | 15 |
| Moscow State Universitylocation not on record | 15 |
| Vitoria, ES | 15 |
| Brussel, BE | 14 |
| Fort Worth, US | 13 |
| Bern, CH | 13 |
| Tuscaloosa, US | 12 |
| Canadian Department of Agriculturelocation not on record | 12 |
| San Sebastián, ES | 12 |
| Wuzhou, CN | 12 |
| Frankfurt am Main | 11 |
| Provincia di Livornolocation not on record | 10 |
| Museo Achille Folettolocation not on record | 10 |
| Saint Louis, US | 10 |
| Canberra, AU | 10 |
| Austin, US | 10 |
| UIBlocation not on record | 10 |
| Madrid, ES | 10 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 9 |
| ESP010location not on record | 8 |
| Mississippi State, US | 8 |
| Bronx, US | 8 |
| Fayetteville, US | 8 |
| GMBAlocation not on record | 8 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Mlocation not on record | 7 |
| GJOlocation not on record | 7 |
| Paris, FR | 7 |
| CJBGlocation not on record | 7 |
| Uniwersytet Warszawskilocation not on record | 7 |
| PRT004location not on record | 7 |
| Santiago de Compostela, ES | 7 |
| Adelaide, AU | 7 |
| EL PASO, US | 7 |
| Odawara, JP | 7 |
| Barcelona, ES | 6 |
| Sagamihara, JP | 6 |
| Kew, GB | 6 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 6 |
| PRClocation not on record | 6 |
| Fulda, DE | 6 |
| BAYLUlocation not on record | 6 |
| Salzburg, AT | 6 |
| Bangkok, TH | 5 |
| ISAlocation not on record | 5 |
| Alicante, ES | 5 |
| Nijmegen, NL | 5 |
| Chongqing Museumlocation not on record | 5 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| Uppsala, SE | 5 |
| Granada, ES | 5 |
| Little Rock, US | 5 |
| Philadelphia, US | 4 |
| Trondheim, NO | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Porrentruy, CH | 4 |
| AZE015location not on record | 4 |
| Wellington, NZ | 4 |
| John May Museum of Natural Historylocation not on record | 4 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 4 |
| PrivatHerblocation not on record | 4 |
| Pullman, US | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| Corvallis, US | 4 |
| Jena Microbial Resource Collectionlocation not on record | 4 |
| Davis, US | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Columbia, US | 3 |
| University of Southern Mississippilocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Bourges, FR | 3 |
| SZUlocation not on record | 3 |
| AUAlocation not on record | 3 |
| Dresden, DE | 3 |
| Santa Cruz, US | 3 |
| Riverside, US | 3 |
| Lausanne, CH | 3 |
| Bloomington, US | 3 |
| Rotorua, NZ | 3 |
| Tampa, US | 3 |
| Bergen, NO | 3 |
| Vancouver, CA | 3 |
| Uniwersytet Wrocławskilocation not on record | 3 |
| College Park, US | 3 |
| GZUlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Chiba, JP | 2 |
| Taipei, TW | 2 |
| GAlocation not on record | 2 |
| Durham, US | 2 |
| JBSlocation not on record | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Göteborg, SE | 2 |
| TUR-Alocation not on record | 2 |
| DBF-NHMDlocation not on record | 2 |
| Flagstaff, US | 2 |
| Frauenfeld, CH | 2 |
| Palmerston North, NZ | 2 |
| Rishon Le Zion, IL | 2 |
| Burlington, US | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| University of Stellenboschlocation not on record | 2 |
| Provo, US | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Hitchin Museumlocation not on record | 1 |
| San Isidro, AR | 1 |
| Millersville, US | 1 |
| Jaén, ES | 1 |
| Phoenix, US | 1 |
| Claremont, US | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Springfield, US | 1 |
| Karlsruhe, DE | 1 |
| San Luis Obispo, US | 1 |
| GB | 1 |
| Philadelphia, US | 1 |
| Portland, US | 1 |
| Mexico City, MX | 1 |
| H-AkrKGlocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| TROMlocation not on record | 1 |
| Tomioka, JP | 1 |
| Pittsburg, US | 1 |
| Boumlocation not on record | 1 |
| Tilburg, NL | 1 |
| Sion, CH | 1 |
| San Diego, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| ASUlocation not on record | 1 |
| OLAlocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| Glarus, CH | 1 |
| Pamplona, ES | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Denver, US | 1 |
| Parkville, AU | 1 |
| Québec, CA | 1 |
| Boise, US | 1 |
| WTUlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| nbflocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| CASlocation not on record | 1 |
| Coimbra, PT | 1 |
| Logan, US | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Oswego, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
192 institutions · 2 304 of 2 528 vouchered records shown · 217 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA18 detections
Where the DNA of Trifolium resupinatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found18
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 18 detections have coordinates
Open the map4 countries0
in newly seeded lawn
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.7 °C 15.4–26.0
Seasonal swing summer↔winter19.1 °C
Max temp (day)27.6 °C 20.5–31.1
Min temp (night)18.7 °C 10.4–18.7
Precipitation41.7 mm/mo 31.8–74.4
Air humidity52.8 % 44.1–58.9
Moisture balance-132 mm/mo -133–-28.0
Vapour deficit1,128 Pa 804–1,911
Wind speed3.10 m/s 2.70–3.10
Cloud cover37.2 % 35.0–41.2
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.