Trifolium repens
speciesAt a glance
Occurrence records1 440 733
Data sources14
Biological traits156
DNA specimens169
eDNA detections97
Sources14 archives
Databases and archives Trifolium repens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 440 733 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics169 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources156 traits
Chemical compositionLOTUS · NPASS86 compounds
Occurrence & distributionGBIF1 440 733 records
Environmental DNA2 datasets · 16 countries97 detections
DNA & barcodingBOLD · NCBI169 specimens
Genome at a glanceCCDB · GIFT · GoaT1.2 Gbp
01Narrative
Le Trèfle blanc ou Trèfle rampant, Trifolium repens, est une espèce de plantes à fleurs dicotylédones de la famille des Fabaceae, sous-famille des Faboideae, originaire des régions tempérées de l'Ancien Monde. C'est l'une des espèces les plus répandues du genre Trifolium. Jouant un rôle important comme espèces complémentaires pour sa bonne valeur fourragère dans de très nombreuses prairies, il est considéré comme une adventice dans certaines terres cultivées et des jardins. C'est une plante très basse à tige rampante, reconnaissable à ses inflorescences blanches, parfois un peu rosées, au parfum assez agréable. - Noms vernaculaires - trèfle-blanc, trèfle-rampant, petit-trèfle-blanc, trèfle-bâtard, traînelle, coucou, trifolet, triolet-blanc, trèfle de Hollande.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology23
Fruit length6 mm
⚠ sources differ — AusTraits: 6 mm · GIFT: 4 mm
Fruit width4 mm
Leaf length15 mm
Leaf length max47 mm
Leaf length min3 mm
Leaf mass11.31 mg
Leaf size325 mm²
⚠ sources differ — TRY: 325 mm² · LEDA: 682 mm² · GIFT: 682 mm²
Leaf width12.5 mm
Leaf width max36 mm
Leaf width min3 mm
Plant height0.25 m
⚠ sources differ — GIFT: 0.25 m · AusTraits: 0.15 m · LEDA: 0.35 m · USDA: 0.213 m · TRY: 0.172 m
Plant height generative0.118 m
Plant height max0.6 m
Plant height min0.05 m
Seed length2.46 mm
⚠ sources differ — TRY: 2.46 mm · AusTraits: 1 mm · GIFT: 1 mm
Seed length max1.3 mm
Seed length min1 mm
Seed mass0.594 mg
⚠ sources differ — TRY: 0.594 mg · LEDA: 0.561 mg · GIFT: 0.601 mg
Seed mass max1.36 mg
Seed mass min0.228 mg
Seed volume0.61 mm³
Seed volume max0.64 mm³
Seed volume min0.58 mm³
Life cycle & reproduction42
After harvest regrowth rateModerate
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscencedehiscent
Dispersal typeanimal
Flower colourred
⚠ sources differ — GIFT: red · USDA: White
Flower conspicuousYes
Flower length max12 mm
Flower length min7 mm
Flowering endMay
Flowering startMay
Flowering timennnnnnnnynnn
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual perennial · LEDA: perennials · GIFT: perennial
Lifespan categoryModerate
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprout abilityNo
Resprouting capacityfire_killed
Seed number1 000
Seed spread rateModerate
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateModerate
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment34
Active growth periodSpring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatLow
Climatetemperate
Climberself-supporting
Elevation max3 750 m
Elevation mean2 285 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Herbaceous
Growth form USDAStoloniferous
Habitat GIFTdesert, irrigation channals, meadows: wet, semidesert, shores
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesscompound
Leaf formobovate
Leaf retentionNo
Leaf shapewidely_obovate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationProstrate
Small grainNo
Woodinessnon-woody
Physiology & chemistry28
Anaerobic toleranceMedium
C:N ratioLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantYes
Fire toleranceMedium
Frost free days min150 days
Leaf C:N ratio10.87 g/g
Leaf c448 mg/g
Leaf dry-matter content (LDMC)229 mg/g
⚠ sources differ — TRY: 229 mg/g · LEDA: 183 mg/g
Leaf n39.76 mg/g
Leaf p2.7 mg/g
Moisture useMedium
Nitrogen fixation levelHigh
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max70 in
Precipitation min32 in
Protein potentialHigh
Salinity toleranceLow
Seed longevity index0
Shade toleranceMedium
Soil pH max7.5 pH
Soil pH min5.2 pH
Specific leaf area (SLA)25.55 mm²/mg
⚠ sources differ — TRY: 25.55 mm²/mg · LEDA: 30.7 mm²/mg · GIFT: 31.44 mm²/mg
Temperature min-39 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound776 000 per lb
ToxicityNone
Veneer productNo
Other traits12
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Leaf arrangementalternate
Planting density max40 000 per acre
Planting density min2 500 per acre
Seeds per fruit>1000
Shoot length max50 cm
Shoot length min5 cm
Shoot orientationprostrate
03Chemical composition86 compounds
Compounds documented for Trifolium repens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols11
Oleanane triterpenoids9
Isoflavones8
Aminoacids8
Pterocarpan3
Documented compounds86 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-3-Hydroxy-9-methoxypterocarpan | present | LOTUS | |
| (2R,3S,4R,5R)-2,3,4,5,6-pentahydroxyhexanal | present | LOTUS | |
| (2R,3S,4S,5R)-2,3,4,5,6-pentahydroxyhexanal | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aR,11S,12aS,14aR,14bR)-11-carboxy-4-(hydroxymethyl)-4,6a,6b,8a,11,14b-hexamethyl-9-oxo-2,3,4a,5,6,7,8,10,12,12a,14,14a-dodecahydro-1H-picen-3-yl]oxy]-3,4-dihydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(4S,6aR,8aR,14bR)-9-hydroxy-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-5-[(2S,3R,4S,5R)-4,5-dihydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (±)-Tryptophan | present | LOTUS | |
| 2,3-Dihydroxy-2,4-cyclopentadien-1-one | present | LOTUS | |
| 2-Ammonio-3-sulfanylpropanoate | present | LOTUS | |
| 3,7-Dimethyl-2,6-octadienol | present | LOTUS | |
| 5,7-dihydroxy-2-(4-hydroxyphenyl)-3-[(2S,3R,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | NPASS |
05DNA & barcoding169 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium repens has left across the world's sequence archives.
At a glance
DNA specimens169
Marker genes10
GenBank sequences10
eDNA detections97
Countries23
The DNA barcodea real sequence read deposited for this species
ATCGAAGCCTCTCGCCAATTTCCTATATTGATAGGGGTATTGTGCAGGGCGAATGTTGGCCTCCCGTGAGCTTTATTGCCTCATGGTTGG …
Trifolium repens isolate CL2021-2024 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL4★rbcLa★trnL-F★ITS5★ITS1★ITS2cp-trnL-introntrnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Trifolium repens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 242 060 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Trifolium repens1.24 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidy4× tetraploid · measured
Chromosome records16–642n range32median32mode187records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 32145×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +20
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Chromosome studies in some flowering plants collected in the French Alps (haute Savoie).. Rev. Gn. Bot. , 77: 487-497.
CCDB · ita-fl — POGLIANI M. - 1971. Numeri cromosomici per la flora italiana:86-91.. Inform. Bot. Ital. , 3(2): 155-157.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Hallonová A., 1982: Floristické pomery horskej skupiny Skalky (Strážovské vrchy). - Stredné Slovensko 2: 308-323.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · brit-fl — Coombe, D.E. Watsonia 5: 68-87 (1961)
CCDB · brit-fl — McAllister, H. Pers.comm. to R.J.Gornall : 8.x (1992)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Bot. J. Scotl. : ()
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 252: 79-164(1978).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2958
CCDB · poland — Kazimierski T. and Kazimierska E. M. 1968. Badania miesza?cw z rodzaju Trifolium L. I. Sterylny mieszaniec Trifolium repens L. X T. xerocephalum Frenzl. Acta Soc. Bot. Pol. 37, 549-560.
CCDB · poland — Pogan E., Izmai?ow R. et al. 1983. Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov. Ser. Bot. 25, 57-77.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Semerenko, L. V. 1989. Chromosome numbers in some members of the families Asteraceae, Fabaceae, Orchidaceae and Poaceae from the Berezinsky Biosphere Reservation (Byelorussia) flora. Bot. Žhurn. (Moscow & Leningrad) 74: 1671–1673.
CCDB · ipcn-api-dl — Pandey, K. K., J. E. Grant & E. G. Williams. 1987. Interspecific hybridization between Trifolium repens and T. uniflorum. Austral. J. Bot. 35: 171–182.
CCDB · ipcn-api-dl — Kodama, A. 1989. Karyotype analyses of chromosomes in eighteen species belonging to nine tribes in Leguminosae. Bull. Hiroshima Agric. Coll. 8: 691–706.
CCDB · ipcn-api-dl — Przywara, L., D. W. R. White, P. M. Sanders & D. Maher. 1989. Interspecific hybridization of Trifolium repens with T. hybridum using in ovulo embryo and embryo culture. Ann. Bot. (London) 64: 613–624.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.
CCDB · ipcn-api-dl — Schifino, M. T. & N. R. Paim. 1982. Indução de poliploidia em Trifolium riograndense Burkart. Ci. & Cult. (Sao Paulo) 34: 683.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.
CCDB · ipcn-api-dl — Xu, B. s., R. f. Weng & M. z. Zhang. 1992. Chromosome numbers of Shanghai plants I. Invest. Stud. Nat. 12: 48–65.
CCDB · ipcn-api-dl — Karshibaev, H. K. 1992. Chromosome numbers of some Fabaceae in the Uzbekistan. Pp. 26–27 <in> Tezisy III Soveshchanie po Kariologii Rastenii.
CCDB · ipcn-api-dl — Badr, A. 1995. Electrophoretic studies of seed proteins in relation to chromosomal criteria and the relationships of some taxa of Trifolium. Taxon 44: 183–191.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, J. f. Yan, X. q. Fu & L. y. Wang. 1989. Chromosome numbers and geographical distribution of 68 species of forage plants. Grassl. China 4: 53–60.
CCDB · ipcn-api-dl — Zhang, Z. p., L. h. Wu & Y. f. Kang. 1993. Analyses of karyotypes in six forage grass species of Leguminosae. Bot. Res 1: 60–61.
CCDB · ipcn-api-dl — Schifino-Wittmann, M. T. & M. I. B. Moraes-Fernandes. 1988. Chromosome numbers, karyotypes and meiotic behavior of populations of some Trifolium (Leguminosae) species. Revista Brasil. Genét. 11(2): 379–390.
CCDB · ipcn-api-dl — Yang, D. k. & J. y. Zhou. 1999. The karyotype analysis of 19 species from Shandong. Guihaia 19(4): 349–354.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1975. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 60(6): 864–872.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
+99 more references
2n 1618×CCDB · slov-fl · CCDB · brit-fl · CCDB · iber-fl +10
CCDB · slov-fl — Májovský J. & Murín A., 1990: Amoria orbelica (Velenovsky) Májovský in der Slowakei. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 37: 17-24.
CCDB · brit-fl — Coombe, D.E. Watsonia 5: 68-87 (1961)
CCDB · brit-fl — Kay, Q.O.N., Ab-Shukor, N.A. Watsonia 17: 168-170 (1988)
CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2959
CCDB · fl-europaea — Coombe, 1961
CCDB · ipcn-api-dl — Daniela, I. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 13–14.
CCDB · ipcn-api-dl — Nielsen, I. 1975. Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180–183.
CCDB · ipcn-api-dl — Muñoz Rodriguez, A. F. 1996. Trifolium sect. Paramesus y sect. Trifoliastrum en la Península Ibérica. II. Estudio cariológico. Stud. Bot. Univ. Salamanca 14: 103–128.
CCDB · book-ipcn67-71 — PODLECH, D., & A. DIETERLE. 1969. Chromosomenstudien an afghanischen Pflanzen. Candollea 24: 185-243.
CCDB · book-ipcn75-78 — Nielsen 1975
CCDB · book-ipcn73-74 — CHEN, C.-C., & P.B. GIBSON. 1971. Karyotypes of fifteen Trifolium species in section Amoria. Crop Sci. 11: 441-445.
CCDB · book-indian_vol1 — Podlech, D. & Dieterle, A. '1969
CCDB · CromoCat 2015 — Daniela, I. (1997). IOPB Chromosome Data 11 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 26-27: 13-14.
CCDB · CromoCat 2015 — Nielsen, I. (1975). Chromosome counts in the genus Trifolium. Bot. Tidsskr. 70: 180-183.
CCDB · CromoCat 2015 — Podlech, D. & A. Dieterle. (1969). Chromosomenstudien an afghanischen Pflanzen. Candollea 24(2): 185-243.
CCDB · iapt — IAPT/IOPB Chromosome Data 19
GIFT · GIFT (floras)
2n 308×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +3
CCDB · ipcn-api-dl — Chatterjee, A., S. Ghosh & S. C. Roy. 1989. A cytological survey of eastern Himalayan plants III. Cell Chromosome Res. 12: 22–29.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · book-indian_vol1 — Sharma, A. & Sarkar, A.K. 1967- 1968
CCDB · CromoCat 2015 — Chatterjee, A., Ghosh, S. & Roy, S. C. (1989). A cytological survey of eastern Himalayan plants III. Cell Chromosome Res. 12: 22-29.
CCDB · CromoCat 2015 — Sharma, A. K. (1970). Annual report, 1967-1968 Res. Bull. Univ. Calcutta (Cytogenetics Lab.) 2: 1-50
GIFT · GIFT (floras)
2n 286×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · CromoCat 2015 +1
CCDB · ipcn-api-dl — Astanova, S. B. 1981. Chromosome numbers of Leguminosae of flora in Tajikistan. Dokl. Akad. Nauk Tadziksk. SSR. 24: 61–63. (In Russian).
CCDB · ipcn-api-dl — Sokolovskaya, A. P., N. S. Probatova & E. G. Rudyka. 1989. Chromosome numbers in some species of the flora of the Soviet far east from the families Actinidiaceae, Aristolochiaceae, Fabaceae, Ranunculaceae, Saxifragaceae. Bot. Žhurn. (Moscow & Leningrad) 74: 268–271.
CCDB · book-indian_vol1 — Bleier, H. 1925a, b
CCDB · CromoCat 2015 — Astanova, S. B. (1981). Chromosome numbers of Leguminosae of flora in Tajikistan. Dokl. Akad. Nauk Tadziksk. SSR. 24: 61–63. (In Russian)
CCDB · CromoCat 2015 — Sokolovskaya, A. P., N. S. Probatova & E. G. Rudyka. (1989). Chromosome numbers in some species of the flora of the Soviet far east from the families Actinidiaceae, Aristolochiaceae, Fabaceae, Ranunculaceae, Saxifragaceae Botani?eskij Žurnal (Moscow & Len
GIFT · GIFT (floras)
2n 223×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 · GIFT · GIFT (floras)
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-indian_vol1 — Zhukova, P .G. 1967b
GIFT · GIFT (floras)
2n 243×CCDB · book-ipcn72 · CCDB · book-ipcn67-71
CCDB · book-ipcn72 — KAZIMIERSKI, T . & E.M. KAZIMIERSKI. 1972. Badania mieszancow w rodzaju Trifolium L. IV. Cytogenetyka mieszanca Trifolium repens L. X ~- isthomocarpum Brot. Acta soc. Bot. Poloniae 41: 127-147.
CCDB · book-ipcn67-71 — KAZIMIERSKI, T., & E.M. KAZIMIERSKA. 1970. Badania mieszancow w rodzaju Trifolium L. III. Cechy morfologiczne i cytogenetyka miezanca Trifolium repens L. X Trifolium nigrescens Viv. Acta Soc. Bot. Poloniae 39: 565-592.
CCDB · book-ipcn67-71 — KAZIMIERSKI, T . & E.M. KAZIMIERSKA. 1968. Investigations of hybrid of the genus Trifolium L. I. Sterile hybrid Trifolium repens L. x ! xerocephalum Frenzl. (In Polish) Acta Polsk. Towarz. Bot. 37: 549-560.
2n 643×CCDB · book-indian_vol1 · CCDB · CromoCat 2015 · GIFT · GIFT (floras)
CCDB · book-indian_vol1 — Levan, A. 1942a ; Brewbaker, J .L. & Keirn, W.F. 1953
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
GIFT · GIFT (floras)
2n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kumar, S, Kumari, S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1790
2n 481×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 1615×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Chatterjee, A., S. Ghosh & S. C. Roy. 1989. A cytological survey of eastern Himalayan plants III. Cell Chromosome Res. 12: 22–29.
CCDB · ipcn-api-dl — BHAUMIK, G. H. 1976a. Cytological investigations on some members of the tribe Trifolieae (family Papilionaceae). Sci. & Cult. 42: 322–324.
CCDB · book-ipcn67-71 — KAZIMIERSKI, T . & E.M. KAZIMIERSKA. 1968. Investigations of hybrid of the genus Trifolium L. I. Sterile hybrid Trifolium repens L. x ! xerocephalum Frenzl. (In Polish) Acta Polsk. Towarz. Bot. 37: 549-560.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn75-78 — Bhaumik 1976a
CCDB · Cave1962 — Tiemann & Schreiter 1961
CCDB · CromoCat 2015 — Bhaumik, G. H. (1976a). Cytological investigations on some members of the tribe Trifolieae (family Papilionaceae). Sci. & Cult. 42: 322–324.
CCDB · CromoCat 2015 — Chatterjee, A., Ghosh, S. & Roy, S. C. (1989). A cytological survey of eastern Himalayan plants III. Cell Chromosome Res. 12: 22-29.
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K. (2010). IAPT/IOPB Chromosome Data 9 Taxon 59 (4): 1300-1301
CCDB · CromoCat 2015 — Kazimierski, T. & Kazimierska, E. M. (1968). Investigations of hybrids of the genus Trifolium L. I. Sterile hybrid Trifolium repens L. x T. xerocephalum Frenzl. Acta Polsk. Towarz. Bot. 37: 549-560.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Kumar, S, Kumari, S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1790
n 81×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kumar, S, Kumari, S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1790
n 241×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99.9% BUSCO
08Occurrence & distribution
Record type1 440 733 records
Wild obs. + sensor1 402 331
Museum / vouchered30 106
Cultivated / captive3 137
Other5 159
Origin
Native43 973
Introduced9 286
Range
Area of Occupancy AOO1 209 264 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 357 762≤1 km 277 450≤10 km 497 340>10 km 11 609
1 144 161 georeferenced · 258 170 without coordinates
Open the mapobservation + sensor1 402 331
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 2 661≤1 km 6 249≤10 km 10 330>10 km 961
20 201 georeferenced · 9 905 without coordinates
Open the institutions mapphysical evidence30 106
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy2% within 1 km
≤100 m 1≤1 km 1≤10 km 47>10 km 40
89 georeferenced · 3 048 without coordinates
Open the mapnot free-living3 137
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions323 of 640 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 10 662 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 557 |
| Helsinki, FI | 536 |
| BIO-UNIPIlocation not on record | 516 |
| Moscow State Universitylocation not on record | 478 |
| GBR016location not on record | 477 |
| LDlocation not on record | 477 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 378 |
| Berlin, DE | 370 |
| Philadelphia, US | 290 |
| Olocation not on record | 223 |
| Uniwersytet Warszawskilocation not on record | 212 |
| Odawara, JP | 212 |
| Wuzhou, CN | 205 |
| Bronx, US | 201 |
| Salzburg, AT | 177 |
| Madison, US | 176 |
| Chapel Hill, US | 169 |
| Jyväskylä, FI | 169 |
| Oskarshamn, SE | 165 |
| St. Paul, US | 163 |
| MeiseBGlocation not on record | 154 |
| Saint Louis, US | 147 |
| Christchurch, NZ | 139 |
| Chongqing Museumlocation not on record | 138 |
| TROMlocation not on record | 132 |
| IRL001location not on record | 130 |
| Beijing, CN | 129 |
| Trondheim, NO | 112 |
| SLU Artdatabankenlocation not on record | 103 |
| WTUlocation not on record | 101 |
| Oulu, FI | 95 |
| MAlocation not on record | 93 |
| Albuquerque, US | 93 |
| South Kensington, GB | 89 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 87 |
| Durango, MX | 86 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 86 |
| Turku, FI | 86 |
| College Park, US | 86 |
| Chiba, JP | 86 |
| València, ES | 84 |
| Bergen, NO | 83 |
| Pullman, US | 83 |
| Garðabær, IS | 81 |
| Denver, US | 80 |
| Nagano City, JP | 80 |
| BFLlocation not on record | 80 |
| Bloomington, US | 79 |
| Bangkok, TH | 79 |
| Kuopio, FI | 76 |
| Mount Annan, AU | 74 |
| Görlitz, DE | 71 |
| KMNlocation not on record | 70 |
| New Brunswick, US | 70 |
| Shinshu Universitylocation not on record | 69 |
| Fukushima Universitylocation not on record | 69 |
| Uniwersytet Opolskilocation not on record | 69 |
| Moscow, US | 68 |
| BDBClocation not on record | 68 |
| Ann Arbor, US | 66 |
| Corvallis, US | 65 |
| Québec, CA | 64 |
| Adelaide, AU | 64 |
| NLD037location not on record | 64 |
| Kochi, JP | 63 |
| Université Lavallocation not on record | 63 |
| Tampa, US | 62 |
| GMBAlocation not on record | 61 |
| Karlsruhe, DE | 60 |
| Badajoz, ES | 60 |
| Rotorua, NZ | 60 |
| DMZ botanic gardenlocation not on record | 58 |
| Bern, CH | 57 |
| Hobart, AU | 56 |
| Flagstaff, US | 56 |
| University of New Hampshirelocation not on record | 54 |
| Wlocation not on record | 52 |
| Kew, GB | 52 |
| Adam Mickiewicz University in Poznańlocation not on record | 51 |
| TUR-Alocation not on record | 51 |
| ASUlocation not on record | 50 |
| Acadia Universitylocation not on record | 50 |
| HUN003location not on record | 50 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 49 |
| KURAlocation not on record | 49 |
| Pretoria, ZA | 48 |
| BRNUlocation not on record | 48 |
| Boise, US | 47 |
| Chadron, US | 47 |
| Museo Entomologico de Leonlocation not on record | 46 |
| Arcata, US | 45 |
| Williamsburg, US | 45 |
| BClocation not on record | 44 |
| National Biodiversity Institute, Costa Ricalocation not on record | 44 |
| Riverside, US | 44 |
| Yangling, CN | 44 |
| Fort Worth, US | 43 |
| Bando, JP | 43 |
| BGR001location not on record | 43 |
| Tartu, EE | 43 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 42 |
| Auckland, NZ | 42 |
| Millersville, US | 42 |
| Saint John, CA | 41 |
| University of Stellenboschlocation not on record | 41 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 41 |
| Mexico City, MX | 41 |
| Canberra, AU | 40 |
| Barcelona, ES | 40 |
| Tsukuba, JP | 39 |
| Pittsburg, US | 39 |
| Angwin, US | 39 |
| National Museum of Natural Sciencelocation not on record | 39 |
| CICYTEXlocation not on record | 38 |
| Chicago, US | 38 |
| Burlington, US | 38 |
| Tallinn, EE | 37 |
| Urumqi, CN | 37 |
| Taipei, TW | 37 |
| BAYLUlocation not on record | 36 |
| Green Bay, US | 36 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 36 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 36 |
| Frankfurt am Main | 35 |
| UGentlocation not on record | 35 |
| DOI/NPS, Greenbelt Parklocation not on record | 35 |
| Pocatello, US | 34 |
| Entomological Society of Latvialocation not on record | 33 |
| Porvoo, FI | 33 |
| Davis, US | 31 |
| Claremont, US | 31 |
| Chengdu, CN | 31 |
| Provincia di Livornolocation not on record | 31 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 30 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 30 |
| McWane Science Centerlocation not on record | 29 |
| Spearfish, US | 29 |
| Wellington, NZ | 28 |
| Toyama, JP | 28 |
| Mexico City, MX | 27 |
| Montréal, CA | 27 |
| Iwate Prefectural Museumlocation not on record | 27 |
| EL PASO, US | 27 |
| University of Alberta Museumslocation not on record | 27 |
| Chengdu, CN | 27 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 26 |
| KR | 25 |
| New Haven, US | 25 |
| Victoria, CA | 25 |
| KOMlocation not on record | 25 |
| Jackson, US | 25 |
| Universidad de Caldas (UCaldas)location not on record | 24 |
| Sanda, JP | 23 |
| Kandalaksha State Nature Reservelocation not on record | 23 |
| Missoula, US | 23 |
| Uppsala, SE | 23 |
| Fayetteville, US | 23 |
| Porto Alegre, BR | 22 |
| Bozeman, US | 22 |
| Voronezh State Universitylocation not on record | 21 |
| Jena Microbial Resource Collectionlocation not on record | 21 |
| US | 21 |
| Emporia, US | 21 |
| Kawasaki Shi Tama Ku, JP | 21 |
| 21 | |
| Parkville, AU | 21 |
| Blumenau, BR | 20 |
| Hiratsuka City Museumlocation not on record | 20 |
| Madrid, ES | 20 |
| Toronto, CA | 20 |
| Universidad de Antioquia (UdeA)location not on record | 20 |
| Santa Barbara, US | 20 |
| Universidad Nacional de Colombia (UNAL)location not on record | 20 |
| Taipei, TW | 20 |
| Logan, US | 19 |
| Norfolk, US | 19 |
| Mississippi State, US | 18 |
| PUC-RSlocation not on record | 18 |
| Tuscaloosa, US | 18 |
| Salamanca, ES | 18 |
| Austin, US | 17 |
| National Institute of Biological Resourceslocation not on record | 17 |
| Universidad Católica de Santa Maríalocation not on record | 17 |
| Minia, EG | 17 |
| Sendai, JP | 17 |
| SVN019location not on record | 17 |
| Vancouver, CA | 17 |
| Portland, US | 16 |
| Otaru, JP | 16 |
| Rovaniemi, FI | 16 |
| POL003location not on record | 16 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 16 |
| Allentown, US | 15 |
| San Luis Obispo, US | 15 |
| Natural History Museum Rotterdamlocation not on record | 15 |
| Xiamen, CN | 15 |
| Columbia, US | 15 |
| AZE015location not on record | 15 |
| Caldwell, US | 15 |
| Tomioka, JP | 15 |
| Xinxiang, CN | 15 |
| ESP103location not on record | 15 |
| Durban, ZA | 15 |
| QAUlocation not on record | 15 |
| Guangzhou, CN | 14 |
| Durango, US | 14 |
| Kushiro City Museumlocation not on record | 14 |
| Urumqi, CN | 14 |
| Provo, US | 14 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 14 |
| Mlocation not on record | 14 |
| Paris, FR | 13 |
| Phoenix, US | 13 |
| Staten Island, US | 13 |
| Canadian Department of Agriculturelocation not on record | 13 |
| Universidad Industrial de Santander (UIS)location not on record | 13 |
| Anchorage, US | 13 |
| KIWElocation not on record | 13 |
| Nanjing, CN | 13 |
| Pamplona, ES | 13 |
| Cape Town, ZA | 12 |
| Denton, US | 12 |
| Edinburgh, GB | 12 |
| Ishikawa Museum of Natural Historylocation not on record | 12 |
| Guilin, CN | 12 |
| University of Lethbridgelocation not on record | 12 |
| Turlock, US | 12 |
| GAlocation not on record | 12 |
| UniKSlocation not on record | 12 |
| Lord Fairfax Community Collegelocation not on record | 12 |
| Sagamihara, JP | 12 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 12 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 11 |
| Granada, ES | 11 |
| Wuhan, CN | 11 |
| Dekalb, US | 11 |
| Central China Normal Universitylocation not on record | 11 |
| Aarhus, DK | 11 |
| San Diego, US | 11 |
| Santa Cruz, US | 11 |
| Altos de Pipe, VE | 11 |
| Keene State Universitylocation not on record | 11 |
| Wuhan, CN | 11 |
| Irvine, US | 11 |
| Orem, US | 10 |
| WNNUlocation not on record | 10 |
| GJOlocation not on record | 10 |
| Stockholm, SE | 10 |
| Porrentruy, CH | 10 |
| Knoxville, US | 10 |
| QCNElocation not on record | 10 |
| SXTCMlocation not on record | 10 |
| WINlocation not on record | 10 |
| ROM007location not on record | 10 |
| San Francisco, US | 10 |
| College of the Atlantic, Museumlocation not on record | 10 |
| Kensington, AU | 10 |
| Philadelphia, US | 10 |
| Nagatoro-machi, Chichibu-gun, JP | 10 |
| Tokushima, JP | 10 |
| UChlocation not on record | 9 |
| Córdoba, AR | 9 |
| Lubbock, US | 9 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 9 |
| Museo Achille Folettolocation not on record | 9 |
| Xining, CN | 9 |
| Phyletisches Museum Jenalocation not on record | 9 |
| NSMKlocation not on record | 9 |
| Guatemala City, GT | 9 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 9 |
| Sevilla, ES | 9 |
| Ashland, US | 9 |
| CASlocation not on record | 9 |
| SVK001location not on record | 9 |
| AASlocation not on record | 9 |
| ROM003location not on record | 9 |
| Dover, US | 8 |
| Morgantown, US | 8 |
| Tula State Universitylocation not on record | 8 |
| University of Guelph, OAC Herbariumlocation not on record | 8 |
| Universidad de La Salle (La Salle)location not on record | 8 |
| Durham, US | 8 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 8 |
| Miami, US | 8 |
| PrivatHerblocation not on record | 8 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 7 |
| UNESClocation not on record | 7 |
| Los Angeles, US | 7 |
| Tilburg, NL | 7 |
| DBF-NHMDlocation not on record | 7 |
| Loja, EC | 7 |
| Taipei, TW | 7 |
| Nishihara, JP | 7 |
| KNAMlocation not on record | 7 |
| Lincoln, US | 7 |
| Ciudad de México, MX | 7 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 7 |
| PRT004location not on record | 7 |
| BSBIlocation not on record | 7 |
| Omachi Alpine Museumlocation not on record | 7 |
| Davenport, US | 7 |
| Waverly, US | 7 |
| Johnson City, US | 7 |
| University of Tennessee at Chattanoogalocation not on record | 7 |
| US | 6 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 6 |
| Whitewater, US | 6 |
| Winterthur, CH | 6 |
| Obihiro Centennial City Museumlocation not on record | 6 |
| Korea National Arboretumlocation not on record | 6 |
| Chicago, US | 6 |
| Zapopan, MX | 6 |
| USFS/BHSClocation not on record | 6 |
| ROM023location not on record | 6 |
| Santiago de Compostela, ES | 6 |
| Hudson, US | 6 |
| Fairfax, US | 6 |
| China Agricultural Universitylocation not on record | 6 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 6 |
| Armidale, AU | 6 |
| Alicante, ES | 6 |
| Criciúma, BR | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 6 |
| Ypsilanti, US | 6 |
| TAIElocation not on record | 6 |
| ESP119location not on record | 6 |
| Kathmandu, NP | 6 |
| Cheney, US | 5 |
| Yunnan Universitylocation not on record | 5 |
| IEBlocation not on record | 5 |
| Valparaiso, CL | 5 |
| AUAlocation not on record | 5 |
| Tacoma, US | 5 |
| Ivano-Frankivsk, UA | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Jaén, ES | 5 |
| Pamplona, ES | 5 |
| GB | 5 |
| CZE096location not on record | 5 |
| Maringá, BR | 5 |
| Vitoria, ES | 5 |
| Osaka, JP | 5 |
| UFMGlocation not on record | 5 |
| JBRJlocation not on record | 5 |
| Little Rock, US | 5 |
| San Jose, US | 5 |
| KIRMlocation not on record | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Kunming, CN | 5 |
| UTPLlocation not on record | 5 |
| University of North Carolina at Pembrokelocation not on record | 5 |
| Valdosta State Universitylocation not on record | 5 |
| nbflocation not on record | 4 |
| Chicago, US | 4 |
| Nishihara, JP | 4 |
| SZUlocation not on record | 4 |
| Washington, US | 4 |
| Torreón, MX | 4 |
| Chongqing, CN | 4 |
| La Trobe Universitylocation not on record | 4 |
| Changsha, CN | 4 |
| Córdoba, ES | 4 |
| DASSHlocation not on record | 4 |
| Macomb, US | 4 |
| IWEP FEB RASlocation not on record | 4 |
| Texas Lutheran Universitylocation not on record | 4 |
| San José, CR | 4 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Henderson, US | 4 |
| Wollongong, AU | 4 |
| San Isidro, AR | 4 |
| PRClocation not on record | 4 |
| Banyoles, ES | 4 |
| Mexico City, MX | 4 |
| UTFPR-CPlocation not on record | 4 |
| Jiangxi Universitylocation not on record | 4 |
| Beijing Normal Universitylocation not on record | 4 |
| Portland, US | 4 |
| JP | 4 |
| Museum of the Rockieslocation not on record | 4 |
| Sevilla, ES | 4 |
| Long Beach, US | 4 |
| UIBlocation not on record | 4 |
| IDElocation not on record | 4 |
| GZUlocation not on record | 4 |
| Richmond, US | 3 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 3 |
| Kirksville, US | 3 |
| Northridge, US | 3 |
| JBSlocation not on record | 3 |
| Fulda, DE | 3 |
| Inner Mongolia Universitylocation not on record | 3 |
| OLAlocation not on record | 3 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 3 |
| ISAlocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| EMTCMlocation not on record | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 3 |
| Musée des Confluenceslocation not on record | 3 |
| Jefferson City, US | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| Quito, EC | 3 |
| Cuenca, EC | 3 |
| Juriquilla, MX | 3 |
| Smithsonian Institutionlocation not on record | 3 |
| Universiti Sains Malaysialocation not on record | 3 |
| Clemson, US | 3 |
| JMSlocation not on record | 3 |
| Puebla, MX | 3 |
| Philadelphia, US | 3 |
| Forssa, FI | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| INBIOlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| University of British Columbia, Herbariumlocation not on record | 3 |
| FFPRIlocation not on record | 3 |
| Herbarium of South China Botanical Gardenlocation not on record | 3 |
| Mohonk Preservelocation not on record | 3 |
| San Angelo, US | 3 |
| Grand Junction, US | 3 |
| Tall Timbers Research Stationlocation not on record | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| Laboratorio de Ictiologialocation not on record | 3 |
| Smithfield, AU | 3 |
| Montecillo, Texcoco, MX | 3 |
| Batemans Bay, AU | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 3 |
| Toyota city nature sanctuarylocation not on record | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| ESP010location not on record | 3 |
| Edmonton, CA | 3 |
| UFPRlocation not on record | 3 |
| Brussel, BE | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| FUVATESlocation not on record | 3 |
| Whitehorse, CA | 3 |
| Coimbra, PT | 3 |
| Glarus, CH | 3 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 3 |
| UDESC-CAVlocation not on record | 2 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 2 |
| Corrientes, AR | 2 |
| SIHUlocation not on record | 2 |
| Mount Pleasant, US | 2 |
| Nanjing, CN | 2 |
| Pelotas, BR | 2 |
| Gijón, ES | 2 |
| Brasília, BR | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| DNSMlocation not on record | 2 |
| Rishon Le Zion, IL | 2 |
| Dehra Dun, IN | 2 |
| Chapingo, MX | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| San Sebastián, ES | 2 |
| GHPG$location not on record | 2 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 2 |
| Frauenfeld, CH | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| HUAlocation not on record | 2 |
| Walla Walla, US | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| NSW Office of Environment and Heritagelocation not on record | 2 |
| QVMAGlocation not on record | 2 |
| HUT Culture Collectionlocation not on record | 2 |
| ESP003location not on record | 2 |
| Palmerston North, NZ | 2 |
| Valparaíso, CL | 2 |
| Palmerston, AU | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Antiguo Cuscatlán, SV | 2 |
| CJBGlocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Herb. BBGlocation not on record | 2 |
| US | 2 |
| SJNAlocation not on record | 2 |
| Guiyang, CN | 2 |
| HJAEFlocation not on record | 2 |
| Campo Mourão, BR | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Universidad Católica de Oriente (UCO)location not on record | 2 |
| Guiyang, CN | 2 |
| Pomona Collegelocation not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Zürich, CH | 2 |
| STNFlocation not on record | 2 |
| Mie Prefectural Museumlocation not on record | 2 |
| Kingston, US | 2 |
| Cenargenlocation not on record | 2 |
| Monastir, TN | 2 |
| Brookings, US | 2 |
| National Botanic Garden of Waleslocation not on record | 2 |
| Linares, MX | 2 |
| KNFHClocation not on record | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Yukon Universitylocation not on record | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Shanxi Universitylocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| Rocky Mountain Biological Laboratorylocation not on record | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| NEAUlocation not on record | 2 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 2 |
| Seoul, KR | 2 |
| Jishou Universitylocation not on record | 2 |
| Tempe, US | 2 |
| Akita Prefectural Museumlocation not on record | 2 |
| Pondicherry, IN | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| VALElocation not on record | 2 |
| Lanzhou, CN | 2 |
| CUVClocation not on record | 2 |
| Göteborg, SE | 2 |
| Santa Cruz de la Sierra, BO | 2 |
| Springfield, US | 2 |
| Jinghong, CN | 2 |
| Kyoto Universitylocation not on record | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Bourges, FR | 2 |
| Post Graduate College Bannulocation not on record | 1 |
| Sion, CH | 1 |
| FLADlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| arosemena tola, EC | 1 |
| Iquitos, PE | 1 |
| Lima, PE | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Cambridge, US | 1 |
| USFSlocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Qufu Normal Universitylocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| KNFYlocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Jardín Botánico de Bogotá "José Celestino Mutis" (JBB)location not on record | 1 |
| Facultad de Agronomía - Universidad de la Repúblicalocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Beijing, CN | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| Shenzhen, CN | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| Guizhou Forestry Schoollocation not on record | 1 |
| Mérida, MX | 1 |
| Northeastern Forestry Universitylocation not on record | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| University of Johannesburglocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Columbus State Universitylocation not on record | 1 |
| Mount Berry, US | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Conway, US | 1 |
| Austin, US | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Universidad de los Andes (UniAndes)location not on record | 1 |
| MKD001location not on record | 1 |
| UnBlocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| LPMMBHlocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| National Herbarium and Plant Laboratories, Nepallocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| AZE006location not on record | 1 |
| San Bernardino, US | 1 |
| Asheville, US | 1 |
| Conway, US | 1 |
| KNFSClocation not on record | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| US | 1 |
| Bend, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Dresden, DE | 1 |
| Nijmegen, NL | 1 |
| BioFokuslocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Zürich, CH | 1 |
| Trois-Rivières, CA | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Stephenville, US | 1 |
| Cincinnati, US | 1 |
| La Paz, MX | 1 |
| Tapachula, MX | 1 |
| Cambridge, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| LINUlocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| BMlocation not on record | 1 |
| The Cattle Museumlocation not on record | 1 |
| SEFlocation not on record | 1 |
| Oswego, US | 1 |
| Sucre, BO | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Cusco, PE | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| Podgorica, ME | 1 |
| Elikins, US | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Brisbane, AU | 1 |
| Durham, US | 1 |
| San Francisco, US | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| Montréal, CA | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Brasília, BR | 1 |
| Bothell, US | 1 |
| USP-IBlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| UFSClocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Sapporo, JP | 1 |
| UNIVILLElocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| MEDELlocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| PHlocation not on record | 1 |
640 institutions · 28 118 of 30 106 vouchered records shown · 1 579 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA97 detections
Where the DNA of Trifolium repens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found97
Studies independent surveys2
Countries16
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 97 detections have coordinates
Open the map16 countries0
Moist slope between road and river, Frageria…Riparian|Phenology=FLPalearcticDry soil slightly uphill from Yellowstone Ri…AllotmentNorthern temperate mixedwood stand
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.6 °C 9.80–23.6
Seasonal swing summer↔winter17.9 °C
Max temp (day)19.9 °C 12.9–29.8
Min temp (night)11.9 °C 5.50–17.8
Precipitation72.3 mm/mo 30.3–117
Air humidity57.6 % 47.3–66.3
Moisture balance-51.0 mm/mo -132–30.6
Vapour deficit777 Pa 465–1,493
Wind speed3.20 m/s 2.10–5.40
Cloud cover40.9 % 21.6–55.5
CHELSA 1981–2010, ~9 km grid, at location & month of 56 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.