Trifolium pignantii

Fauché & Chaub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records202

Data sources10

Biological traits9

DNA specimens5

eDNA detections1

Sources10 archives

Databases and archives Trifolium pignantii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility202 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF202 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trifolium pignantii est une espèce de plantes à fleurs de la famille des Fabaceae. Il est originaire de la péninsule balkanique. C'est une plante vivace qui pousse principalement dans les zones tempérées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology3

Seed mass0.92 mg

Seed mass max0.92 mg

Seed mass min0.92 mg

Life cycle & reproduction2

Life formperennial

Raunkiær life formcryptophyte

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formherb

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Trifolium pignantii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pterocarpan4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-3-Hydroxy-9-methoxypterocarpan	present	LOTUS
(-)-Maackiain	present	LOTUS
9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol	present	LOTUS
Medicarpin	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium pignantii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ312128.1 ↗731 bp

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACACGTGAATCAGTTTGAACACATAGGGTTGG …

Trifolium pignantii strain USDA NPGS G 31423 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trifolium pignantii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Petrova, A. V. & S. I. KOZUHAROV. 1982. Cytotaxonomic study of Trifolium L. in Bulgaria: I. Fitologija 19: 3–23. (In Bulgarian).

CCDB · book-ipcn73-74 — KOZUHAROV, S. I. , A. V. PETROVA, & T. MARKOV A. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.988 ↗

08Occurrence & distribution

Record type202 records

Wild obs. + sensor47

Museum / vouchered155

Range

Area of Occupancy AOO684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 23≤1 km 10≤10 km 1>10 km 1

35 georeferenced · 12 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 11≤1 km 3≤10 km 1

15 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	73
LDlocation not on record	51
BRNUlocation not on record	11
Frankfurt am Main	4
Wlocation not on record	3
School of Biology, Aristotle University of Thessalonikilocation not on record	3
MAlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
València, ES	2
GJOlocation not on record	1
Tilburg, NL	1
GZUlocation not on record	1
Uppsala, SE	1

13 institutions · 155 of 155 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Trifolium pignantii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)