Trifolium parryi

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records1 207

Data sources11

Biological traits13

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Trifolium parryi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 207 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF1 207 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trifolium parryi là một loài thực vật có hoa trong họ Đậu. Loài này được A.Gray miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Leaf size429 mm²

Plant height0.081 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formperennial

Life spanperennial

Habitat & environment4

Climatesubalpine or subarctic

Climberself-supporting

Growth formSubshrub, Forb/herb

Woodinessnon-woody

Physiology & chemistry4

Leaf C:N ratio15.91 g/g

Leaf c420 mg/g

Leaf n26.5 mg/g

Specific leaf area (SLA)13.73 mm²/mg

03Chemical composition3 compounds

Compounds documented for Trifolium parryi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pterocarpan3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-3-Hydroxy-9-methoxypterocarpan	present	LOTUS
9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol	present	LOTUS
Medicarpin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium parryi has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ312212.1 ↗729 bp

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACACGTGAATCAGTTTGAACACATAGGGTTGG …

Trifolium parryi strain N. L. Taylor Clover Germplasm Center Accession S-111-4 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trifolium parryi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–322n range24median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · book-ipcn65 · CCDB · book-ipcn67-71

CCDB · book-ipcn65 — Mosquin & G. 1965

CCDB · book-ipcn67-71 — LOEVE, A, D. LOEVE, & B.M. KAPOOR. 1971. Cytotaxonomy of a century of Rocky Mountain orophytes. Arctic & Alpine Res. 3: 139-165.

2n 322×CCDB · book-ipcn65 · CCDB · book-ipcn67-71

CCDB · book-ipcn65 — Mosquin & G. 1965

CCDB · book-ipcn67-71 — LOEVE, A, D. LOEVE, & B.M. KAPOOR. 1971. Cytotaxonomy of a century of Rocky Mountain orophytes. Arctic & Alpine Res. 3: 139-165.

n 121×CCDB · Cave1962

CCDB · Cave1962 — Wiens & H. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.992 ↗

08Occurrence & distribution

Record type1 207 records

Wild obs. + sensor812

Museum / vouchered392

Other3

Range

Area of Occupancy AOO2 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 461≤1 km 80≤10 km 42>10 km 22

605 georeferenced · 207 without coordinates

Open the mapobservation + sensor812

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 25≤1 km 97≤10 km 74>10 km 6

202 georeferenced · 190 without coordinates

Open the institutions mapphysical evidence392

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions34 of 48 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	86
Denver, US	54
Musee des Dinosaures d'Esperaza (Aude)location not on record	52
Bronx, US	50
Rocky Mountain Biological Laboratorylocation not on record	19
Missoula, US	12
Moscow, US	7
Orem, US	7
Pomona Collegelocation not on record	7
Claremont, US	7
Pocatello, US	7
Durango, US	6
Flagstaff, US	5
Logan, US	5
Bozeman, US	4
DOI/NPS, Greenbelt Parklocation not on record	4
Riverside, US	4
LDlocation not on record	4
Saint Louis, US	3
Bangkok, TH	3
Chadron, US	3
Grand Junction, US	3
Tempe, US	3
Provo, US	2
Boise, US	2
Caldwell, US	2
Wuzhou, CN	2
Wlocation not on record	2
University of Stellenboschlocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
ASUlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Pittsburg, US	1
Pullman, US	1
GB	1
Cambridge, US	1
US	1
Weber State Universitylocation not on record	1
Dekalb, US	1
Jena Microbial Resource Collectionlocation not on record	1
Phoenix, US	1
Albuquerque, US	1
San Luis Obispo, US	1
Chicago, US	1
Santa Barbara, US	1
Mississippi State, US	1
Lubbock, US	1
WTUlocation not on record	1

48 institutions · 386 of 392 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Trifolium parryi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trifolium parryi

At a glance

Sources11 archives

Size & morphology2

Life cycle & reproduction3

Habitat & environment4

Physiology & chemistry4

Compound class profile1 class

Documented compounds3 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 207 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions34 of 48 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 207 records