Trifolium pannonicum

Jacq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records825

Data sources12

Biological traits18

DNA specimens15

eDNA detections29

Sources12 archives

Databases and archives Trifolium pannonicum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility825 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Chemical compositionLOTUS · NPASS174 compounds

Occurrence & distributionGBIF825 records

Environmental DNA2 datasets · 2 countries29 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB5.7 Gbp

01Narrative

Le Trèfle de Hongrie ou Trèfle de Pannonie est une espèce de plantes de la famille des Fabacées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology6

Plant height0.575 m

Plant height max0.8 m

Plant height min0.2 m

Seed mass3.23 mg

⚠ sources differ — TRY: 3.23 mg · GIFT: 2.21 mg

Seed mass max3.45 mg

Seed mass min1.2 mg

Life cycle & reproduction5

Flowering endJul

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Growth formherb

Habitat GIFTdry meadows, wood margins, open woods

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition174 compounds

Compounds documented for Trifolium pannonicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chamigrane sesquiterpenoids26

Parguerane diterpenoids13

Dactylomelane diterpenoids8

Oxasqualenoids6

Laurane sesquiterpenoids6

Documented compounds174 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-3-Hydroxy-9-methoxypterocarpan	present	LOTUS
(1aR,1bR,3R,3aR,5S,7bR,9R,9aR)-5-[(1R)-1-bromo-2-hydroxyethyl]-1a,5,7b-trimethyl-1,1b,2,3,3a,4,6,8,9,9a-decahydrocyclopropa[a]phenanthrene-3,9-diol	present	NPASS
(1aR,1bR,3R,3aR,5S,7bR,9R,9aR)-5-[(1S)-1-bromo-2-hydroxyethyl]-1a,5,7b-trimethyl-1,1b,2,3,3a,4,6,8,9,9a-decahydrocyclopropa[a]phenanthrene-3,9-diol	present	NPASS
(1aR,4S,4aR,8R,8aS)-1a,4,6,6-tetramethyl-1,2,3,4,4a,5,7,8-octahydrocyclopropa[i]naphthalen-8-ol	present	NPASS
(1aS,1bR,3R,3aR,5S,7bR,9aR)-5-[(1R)-1-bromo-2-hydroxyethyl]-1a,5,7b-trimethyl-1,1b,2,3,3a,4,6,8,9,9a-decahydrocyclopropa[a]phenanthren-3-ol	present	NPASS
(1aS,1bS,3R,3aR,5S,7bR,9R,9aR)-5-[(1R)-1-bromo-2-hydroxyethyl]-1a-(hydroxymethyl)-5,7b-dimethyl-1,1b,2,3,3a,4,6,8,9,9a-decahydrocyclopropa[a]phenanthrene-3,9-diol	present	NPASS
(1R,1'R,2R,2'R,4S)-2'-bromo-1'-chloro-1,1',3,3-tetramethylspiro[7-oxabicyclo[2.2.1]heptane-2,4'-cyclohexane]	present	NPASS
(1R,2R,4R)-4-bromo-2-[2-[(2S,3R,6S)-3-bromo-6-[(1S)-2-chloro-1-hydroxyethyl]-2,6-dimethyloxan-2-yl]ethyl]-1,3,3-trimethylcyclohexan-1-ol	present	NPASS
(1R,2R,4R)-4-bromo-2-[2-[(2S,3R,6S)-3-bromo-6-[(1S)-2-chloro-1-hydroxyethyl]-2,6-dimethyloxan-2-yl]ethyl]-3,3-dimethylcyclohexan-1-ol	present	NPASS
(1R,2R,4S)-2-bromo-4-[(1S,4S)-4-bromo-3,3-dimethylcyclohexyl]-1-methyl-7-oxabicyclo[2.2.1]heptane	present	NPASS

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium pannonicum has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes5

GenBank sequences10

eDNA detections29

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMG237210.1 ↗342 bpCanada · 1940

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATC …

Trifolium pannonicum voucher CCDB-24801-A05 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS9★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trifolium pannonicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 657 730 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Trifolium pannonicum5.66 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 126 n = 63

Ploidypolyploid inferred

Chromosome records126–1302n range128median126mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1262×CCDB · ita-fl · CCDB · ipcn-api-dl

CCDB · ita-fl — CODIGNOLA A., MAFFEI M. - 1984 (1983). Numeri cromosomici per la flora italiana:937-940.. Inform. Bot. Ital. , 15(1): 35-38.

CCDB · ipcn-api-dl — Codignola, A. & M. Maffei. 1983. Numeri cromosomici per la Flora Italiana: 937-940. Inform. Bot. Ital. 15: 35–38.

2n 1302×CCDB · book-ipcn73-74 · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn73-74 — KUZMANOV, B.A., & G. STANCEV. 1973. In IOPB Chromosome number repol1 XL. Taxon22:285-291. I

CCDB · book-atlas-flowering-plants — Noda 1946

2n 1281×CCDB · book-ipcn72

CCDB · book-ipcn72 — KUZMANOV, B.A., & G. STANCEV. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type825 records

Wild obs. + sensor604

Museum / vouchered198

Cultivated / captive6

Other17

Origin

Introduced50

Range

Area of Occupancy AOO1 868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 100≤1 km 239≤10 km 95>10 km 28

462 georeferenced · 142 without coordinates

Open the mapobservation + sensor604

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 19≤1 km 14≤10 km 32>10 km 23

88 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence198

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 5 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	43
BRNUlocation not on record	24
KFGBlocation not on record	23
Uniwersytet Wrocławskilocation not on record	12
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	9
Moscow State Universitylocation not on record	7
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	6
ROM007location not on record	5
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	4
BClocation not on record	3
Kew, GB	3
GJOlocation not on record	3
Wlocation not on record	3
Voronezh State Universitylocation not on record	3
Kostrzyca Forest Gene Banklocation not on record	3
Oskarshamn, SE	3
PRClocation not on record	3
Berlin, DE	2
Görlitz, DE	2
Durham, US	2
MAlocation not on record	2
Bern, CH	1
Podgorica, ME	1
Uppsala, SE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
MeiseBGlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Université Lavallocation not on record	1
GBR016location not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
POL003location not on record	1

32 institutions · 179 of 198 vouchered records shown · 18 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA29 detections

Where the DNA of Trifolium pannonicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

cultivated of wild UK sourceplants about one foot high; flowers creamy w…cultivated

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter19.3 °C

Max temp (day)19.6 °C

Min temp (night)10.8 °C

Precipitation118 mm/mo

Air humidity60.7 %

Moisture balance-4.80 mm/mo

Vapour deficit702 Pa

Wind speed4.40 m/s

Cloud cover30.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)