Trifolium oliganthum — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records780

Data sources10

Biological traits14

DNA specimens10

eDNA detections5

Sources10 archives

Databases and archives Trifolium oliganthum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility780 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF780 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Trifolium oliganthum is a species of clover known by the common name fewflower clover. It is native to western coastal and montane North America from British Columbia to California, the Sierra Nevada, and to Baja California, where it occurs in many types of habitat.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.06 mg

Seed mass max1.06 mg

Seed mass min1.06 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition4 compounds

Compounds documented for Trifolium oliganthum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pterocarpan4

Documented compounds4 total

Compound	Amount	Source
(-)-3-Hydroxy-9-methoxypterocarpan	present	LOTUS
(-)-Maackiain	present	LOTUS
9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol	present	LOTUS
Medicarpin	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium oliganthum has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ624461.1 ↗728 bpUSA

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACACGTGAATCAGTTTGAATACATAAGGTTGG …

Trifolium oliganthum bio-material R. Morgan personal collection W44 from USA small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcLrbcLaITS9ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type780 records

Wild obs. + sensor329

Museum / vouchered450

Other1

Range

Area of Occupancy AOO1 956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 208≤1 km 14≤10 km 5>10 km 11

238 georeferenced · 91 without coordinates

Open the mapobservation + sensor329

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 30≤1 km 107≤10 km 83>10 km 6

226 georeferenced · 224 without coordinates

Open the institutions mapphysical evidence450

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	60
WTUlocation not on record	52
Santa Cruz, US	27
Davis, US	26
Pullman, US	24
Claremont, US	23
Santa Barbara, US	20
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	18
Arcata, US	17
Corvallis, US	16
San Luis Obispo, US	16
Riverside, US	10
Canadian Department of Agriculturelocation not on record	8
Philadelphia, US	4
Vancouver, CA	4
Turlock, US	4
CASlocation not on record	3
Wuzhou, CN	3
Boise, US	3
ASUlocation not on record	2
Angwin, US	2
University of British Columbia, Herbariumlocation not on record	2
Portland, US	2
Bronx, US	2
San Diego, US	2
Oskarshamn, SE	1
Cheney, US	1
Bloomington, US	1
Ashland, US	1
Beijing, CN	1
Los Angeles, US	1
Moscow, US	1
DOI/NPS, San Juan Island National Historical Parklocation not on record	1
Logan, US	1
EL PASO, US	1
GZUlocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
Bend, US	1
San Jose, US	1
Cambridge, US	1

40 institutions · 365 of 450 vouchered records shown · 85 without an institution code

09Environmental DNA5 detections

Where the DNA of Trifolium oliganthum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Grassy places.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 11.2–13.0

Seasonal swing summer↔winter11.2 °C

Max temp (day)14.7 °C 13.1–16.3

Min temp (night)9.80 °C

Precipitation48.2 mm/mo 40.0–56.4

Air humidity59.4 % 57.7–61.1

Vapour deficit576 Pa 517–635

Cloud cover43.0 % 42.7–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.