Trifolium obtusiflorum

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Trifolium

At a glance

Occurrence records979

Data sources11

Biological traits10

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Trifolium obtusiflorum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility979 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF979 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trifolium obtusiflorum is a species of clover known by the common name clammy clover. It is native to California in the Peninsular, Transverse, Sierra Nevada, and the California Coast Ranges and Cascade Range into southwestern Oregon. It grows in moist habitat such as marshes and streambanks, and disturbed areas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trifolium obtusiflorum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ624448.1 ↗728 bpMexico · 1999

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTTACATGCAGACCAACACGTGAATCAGTTTGAATACATAAGGTTGG …

Trifolium obtusiflorum bio-material R. Morgan personal collection W7 from Mexico small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★rbcLa★ITS10

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trifolium obtusiflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Wexelsen 1928

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.992 ↗

08Occurrence & distribution

Record type979 records

Wild obs. + sensor452

Museum / vouchered525

Other2

Origin

Native67

Range

Area of Occupancy AOO2 668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 264≤1 km 27≤10 km 18>10 km 17

326 georeferenced · 126 without coordinates

Open the mapobservation + sensor452

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 26≤1 km 113≤10 km 109>10 km 5

253 georeferenced · 272 without coordinates

Open the institutions mapphysical evidence525

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	70
Riverside, US	65
San Diego, US	47
Davis, US	42
Santa Barbara, US	29
San Luis Obispo, US	27
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	25
Canadian Department of Agriculturelocation not on record	16
Santa Cruz, US	16
Arcata, US	10
Angwin, US	10
Corvallis, US	6
Los Angeles, US	6
US	6
San Jose, US	5
Irvine, US	5
Turlock, US	4
LDlocation not on record	3
Severin-McDaniel Insect Collectionlocation not on record	2
University of Stellenboschlocation not on record	2
Fort Bragg, US	1
CASlocation not on record	1
Philadelphia, US	1
Flagstaff, US	1
Chongqing Museumlocation not on record	1
Whitehorse, CA	1
Mexico City, MX	1
Logan, US	1
Bronx, US	1
San Francisco, US	1
Northridge, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Long Beach, US	1
Moscow, US	1
Fredericton Stock Culture Collectionlocation not on record	1
ASUlocation not on record	1
Bloomington, US	1

37 institutions · 413 of 525 vouchered records shown · 112 without an institution code

09Environmental DNA2 detections

Where the DNA of Trifolium obtusiflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Riparian zone with Typha, Salix spp., Toxico…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 20.5–20.5

Seasonal swing summer↔winter13.7 °C

Max temp (day)28.2 °C

Min temp (night)13.7 °C

Precipitation3.80 mm/mo

Air humidity53.6 %

Moisture balance-154 mm/mo

Vapour deficit1,124 Pa

Wind speed1.60 m/s

Cloud cover16.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)